Overview
NameMedtr0028s0020.1
Unique NameMedtr0028s0020.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length153
Homology
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502133513|ref|XP_004501791.1| (PREDICTED: uncharacterized protein LOC101505789 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502169501|ref|XP_004514621.1| (PREDICTED: uncharacterized protein LOC101503926 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502183273|ref|XP_004517101.1| (PREDICTED: uncharacterized protein LOC101502557, partial [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502173665|ref|XP_004515382.1| (PREDICTED: uncharacterized protein LOC101499978 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502104720|ref|XP_004492626.1| (PREDICTED: uncharacterized protein LOC101494551 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502168560|ref|XP_004514415.1| (PREDICTED: uncharacterized protein LOC101492740 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502165041|ref|XP_004513387.1| (PREDICTED: uncharacterized protein LOC101512055 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502178116|ref|XP_004516182.1| (PREDICTED: uncharacterized protein LOC101508343 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502174399|ref|XP_004515505.1| (PREDICTED: uncharacterized protein LOC101501679, partial [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502087139|ref|XP_004488440.1| (PREDICTED: uncharacterized protein LOC101489468 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0020.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502133513|ref|XP_004501791.1|3.985870e-562.86PREDICTED: uncharacterized protein LOC101505789 [C... [more]
gi|502169501|ref|XP_004514621.1|4.374290e-562.86PREDICTED: uncharacterized protein LOC101503926 [C... [more]
gi|502183273|ref|XP_004517101.1|4.480420e-562.86PREDICTED: uncharacterized protein LOC101502557, p... [more]
gi|502173665|ref|XP_004515382.1|5.076690e-565.71PREDICTED: uncharacterized protein LOC101499978 [C... [more]
gi|502104720|ref|XP_004492626.1|5.321530e-552.78PREDICTED: uncharacterized protein LOC101494551 [C... [more]
gi|502168560|ref|XP_004514415.1|5.754880e-552.78PREDICTED: uncharacterized protein LOC101492740 [C... [more]
gi|502165041|ref|XP_004513387.1|6.911150e-552.78PREDICTED: uncharacterized protein LOC101512055 [C... [more]
gi|502178116|ref|XP_004516182.1|8.698470e-552.78PREDICTED: uncharacterized protein LOC101508343 [C... [more]
gi|502174399|ref|XP_004515505.1|1.059770e-452.78PREDICTED: uncharacterized protein LOC101501679, p... [more]
gi|502087139|ref|XP_004488440.1|1.273880e-460.00PREDICTED: uncharacterized protein LOC101489468 [C... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0020.1 ID=Medtr0028s0020.1|Name=Medtr0028s0020.1|organism=Medicago truncatula|type=mRNA|length=153bp
ATGTTTACAGGTTCTATATATAATAAGCGACTACGGCGTTACAATGTGCA
AGTTAGAGATAACCTCACGGTTGAGATTTTACCAGTGAGAATTGAAGGTC
GTGAAGTGAAGACGTTGAGAGGCAAGGAGATACCTCTTGTGAAGGTCGTT
TAG
back to top