Overview
NameMedtr0028s0020.1
Unique NameMedtr0028s0020.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length153
Homology
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502180540|ref|XP_004516660.1| (PREDICTED: uncharacterized protein LOC101503616, partial [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502166779|ref|XP_004513978.1| (PREDICTED: uncharacterized protein LOC101509059 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502165298|ref|XP_004513514.1| (PREDICTED: uncharacterized protein LOC101505509 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502166776|ref|XP_004513977.1| (PREDICTED: uncharacterized protein LOC101508115 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502146854|ref|XP_004506637.1| (PREDICTED: uncharacterized protein LOC101514385 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502182822|ref|XP_004517002.1| (PREDICTED: uncharacterized protein LOC101514265 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502158731|ref|XP_004511260.1| (PREDICTED: uncharacterized protein LOC101506151 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502174295|ref|XP_004515480.1| (PREDICTED: uncharacterized protein LOC101489934, partial [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502179725|ref|XP_004516484.1| (PREDICTED: uncharacterized protein LOC101509289 [Cicer arietinum])
BLAST of Medtr0028s0020.1 vs. NCBI nr
Match: gi|502168947|ref|XP_004514501.1| (PREDICTED: uncharacterized protein LOC101498585 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0020.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180540|ref|XP_004516660.1|1.776340e-668.57PREDICTED: uncharacterized protein LOC101503616, p... [more]
gi|502166779|ref|XP_004513978.1|2.240550e-660.00PREDICTED: uncharacterized protein LOC101509059 [C... [more]
gi|502165298|ref|XP_004513514.1|1.695160e-565.71PREDICTED: uncharacterized protein LOC101505509 [C... [more]
gi|502166776|ref|XP_004513977.1|2.038220e-565.71PREDICTED: uncharacterized protein LOC101508115 [C... [more]
gi|502146854|ref|XP_004506637.1|2.104430e-555.00PREDICTED: uncharacterized protein LOC101514385 [C... [more]
gi|502182822|ref|XP_004517002.1|2.429940e-562.86PREDICTED: uncharacterized protein LOC101514265 [C... [more]
gi|502158731|ref|XP_004511260.1|2.530490e-562.86PREDICTED: uncharacterized protein LOC101506151 [C... [more]
gi|502174295|ref|XP_004515480.1|2.861960e-562.86PREDICTED: uncharacterized protein LOC101489934, p... [more]
gi|502179725|ref|XP_004516484.1|3.447830e-551.43PREDICTED: uncharacterized protein LOC101509289 [C... [more]
gi|502168947|ref|XP_004514501.1|3.535820e-552.78PREDICTED: uncharacterized protein LOC101498585 [C... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0020.1 ID=Medtr0028s0020.1|Name=Medtr0028s0020.1|organism=Medicago truncatula|type=mRNA|length=153bp
ATGTTTACAGGTTCTATATATAATAAGCGACTACGGCGTTACAATGTGCA
AGTTAGAGATAACCTCACGGTTGAGATTTTACCAGTGAGAATTGAAGGTC
GTGAAGTGAAGACGTTGAGAGGCAAGGAGATACCTCTTGTGAAGGTCGTT
TAG
back to top