Overview
NameMedtr0027s0260.1
Unique NameMedtr0027s0260.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length897
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0005975 carbohydrate metabolic process
biological_process GO:0030447 filamentous growth
biological_process GO:0044182 filamentous growth of a population of unicellular organisms
biological_process GO:0040007 growth
biological_process GO:0044699 single-organism process
cellular_component GO:0005575 cellular_component
cellular_component GO:0005576 extracellular region
molecular_function GO:0003824 catalytic activity
molecular_function GO:0043169 cation binding
molecular_function GO:0004568 chitinase activity
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0016798 hydrolase activity, acting on glycosyl bonds
molecular_function GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds
molecular_function GO:0003674 molecular_function
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00704.23148354-14901329-2482-246116.89e-38120.11.2e-34

Homology
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|502158603|ref|XP_004511214.1| (PREDICTED: acidic endochitinase-like [Cicer arietinum])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|356567519|ref|XP_003551966.1| (PREDICTED: hevamine-A-like [Glycine max])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|356567523|ref|XP_003551968.1| (PREDICTED: hevamine-A-like [Glycine max])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|356499861|ref|XP_003518754.1| (PREDICTED: hevamine-A-like [Glycine max])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|356494895|ref|XP_003516317.1| (PREDICTED: hevamine-A-like [Glycine max])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|356570021|ref|XP_003553191.1| (PREDICTED: acidic endochitinase-like [Glycine max])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|225454383|ref|XP_002279147.1| (PREDICTED: acidic endochitinase [Vitis vinifera])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|502094104|ref|XP_004490140.1| (PREDICTED: acidic endochitinase-like [Cicer arietinum])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|224064085|ref|XP_002301383.1| (chitinase family protein [Populus trichocarpa] >gi|222843109|gb|EEE80656.1| chitinase family protein [Populus trichocarpa])
BLAST of Medtr0027s0260.1 vs. NCBI nr
Match: gi|119393870|gb|ABL74451.1| (class III chitinase [Casuarina glauca])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0260.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502158603|ref|XP_004511214.1|0.000000e+093.58PREDICTED: acidic endochitinase-like [Cicer arieti... [more]
gi|356567519|ref|XP_003551966.1|0.000000e+087.84PREDICTED: hevamine-A-like [Glycine max][more]
gi|356567523|ref|XP_003551968.1|0.000000e+088.51PREDICTED: hevamine-A-like [Glycine max][more]
gi|356499861|ref|XP_003518754.1|2.158710e-17483.85PREDICTED: hevamine-A-like [Glycine max][more]
gi|356494895|ref|XP_003516317.1|9.337230e-17483.51PREDICTED: hevamine-A-like [Glycine max][more]
gi|356570021|ref|XP_003553191.1|1.140280e-17382.72PREDICTED: acidic endochitinase-like [Glycine max][more]
gi|225454383|ref|XP_002279147.1|1.664040e-17279.87PREDICTED: acidic endochitinase [Vitis vinifera][more]
gi|502094104|ref|XP_004490140.1|1.979090e-17281.23PREDICTED: acidic endochitinase-like [Cicer arieti... [more]
gi|224064085|ref|XP_002301383.1|2.528580e-17177.52chitinase family protein [Populus trichocarpa] >gi... [more]
gi|119393870|gb|ABL74451.1|2.356360e-16977.18class III chitinase [Casuarina glauca][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001579Glycoside hydrolase, chitinase active sitePROSITEPS01095CHITINASE_18coord: 146..154
score
IPR013781Glycoside hydrolase, subgroup, catalytic coreGENE3D3.20.20.80no descriptioncoord: 25..298
score: 8.5e
IPR017853Glycoside hydrolase, superfamilySUPERFAMILY51445(Trans)glycosidasescoord: 24..298
score: 6.3
NoneNo IPR availableSEGsegsegcoord: 102..116
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0260.1 ID=Medtr0027s0260.1|Name=Medtr0027s0260.1|organism=Medicago truncatula|type=mRNA|length=897bp
ATGAAAATGGCGTTGAAATCAACTATCTCATTCACTTTCTTCTCCTTAGT
CATTTTAGCACTGGCAAATGATTCTAATGCTGGCAAAATTTCAATTTATT
GGGGCCAGAATGGAAACGAGGGCACGTTAGCCGAGGCTTGTGCCACAGGG
AACTACGAATATGTGATCATAGCCTTCTTACCAACCTTCGGTGATGGCCA
AACTCCAATGATCAATCTAGCTGGTCATTGCGATCCATACAGCAACGAGT
GCACTGGCTTAAGCTCAGACATCAAATCATGTCAAGCCAAAGGCATCAAA
GTATTGTTGTCATTAGGAGGAGGTGCTGGAAGCTACTCAATTGCATCCAC
ACAAGATGCAAAAAGTGTAGCAACTTACCTTTGGAATAACTTCTTGGGTG
GACAATCTTCGTCTCGCCCTCTTGGTCCTGCTGTTCTTGACGGCATCGAC
TTCGATATTGAAGGAGGGTCAAACCAACATTGGGGTGATCTTGCCAAGTA
CCTTAAAGGGTATAACGGGAAGAAAGTTTACATAACTGCAGCTCCTCAGT
GTCCATTTCCTGATGCTTGGATAGGAAATGCACTTACAACAGGCCTCTTT
GATTATGTTTGGGTACAGTTCTACAATAACCCTCCTTGTCAATACAATCC
TGGTGAAATTAGCAACCTTGAAGATGCATGGAAGCAGTGGACATCAGGTA
TCCCTGCAAACAAGATATTCTTGGGGTTACCTGCTTCTCCAGAGGCTGCA
GGCAGTGGCTTCATTCCTGCTACTGATCTTACTTCCACTGTGCTTCCAGC
TATTAAAGGTTCTGCTAAATATGGCGGTGTTATGCTGTGGTCTAGGTATG
ATGATGTTCAGAGTGGTTATAGCTCCTCCATCAAGAGCCATGTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001579Glycoside hydrolase, chitinase active site
IPR013781Glycoside hydrolase, subgroup, catalytic core
IPR017853Glycoside hydrolase, superfamily
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0005975carbohydrate metabolic process
GO:0040007growth
GO:0008150biological_process
GO:0030447filamentous growth
GO:0044182filamentous growth of a population of unicellular organisms
GO:0044699single-organism process
Vocabulary: Molecular Function
TermDefinition
GO:0003824catalytic activity
GO:0043169cation binding
GO:0003674molecular_function
GO:0004553hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0004568chitinase activity
GO:0016787hydrolase activity
GO:0016798hydrolase activity, acting on glycosyl bonds
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0005576extracellular region