Overview
NameMedtr0027s0250.1
Unique NameMedtr0027s0250.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length366
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0022607 cellular component assembly
biological_process GO:0044085 cellular component biogenesis
biological_process GO:0016043 cellular component organization
biological_process GO:0071840 cellular component organization or biogenesis
biological_process GO:0034622 cellular macromolecular complex assembly
biological_process GO:0009987 cellular process
biological_process GO:0065003 macromolecular complex assembly
biological_process GO:0043933 macromolecular complex subunit organization
biological_process GO:0070925 organelle assembly
biological_process GO:0006996 organelle organization
biological_process GO:0022618 ribonucleoprotein complex assembly
biological_process GO:0022613 ribonucleoprotein complex biogenesis
biological_process GO:0071826 ribonucleoprotein complex subunit organization
biological_process GO:0000027 ribosomal large subunit assembly
biological_process GO:0042273 ribosomal large subunit biogenesis
biological_process GO:0042255 ribosome assembly
biological_process GO:0042254 ribosome biogenesis
biological_process GO:0006412 translation
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0043226 organelle
cellular_component GO:0005840 ribosome
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0019843 rRNA binding
molecular_function GO:0003735 structural constituent of ribosome
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00453.13145579-1458692-9812-108140.11.5e-45140.21.8e-41

Homology
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|351727347|ref|NP_001235366.1| (uncharacterized protein LOC100527387 [Glycine max] >gi|255632234|gb|ACU16475.1| unknown [Glycine max])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|502098066|ref|XP_004491147.1| (PREDICTED: 50S ribosomal protein L20-like isoform X1 [Cicer arietinum] >gi|502098070|ref|XP_004491148.1| PREDICTED: 50S ribosomal protein L20-like isoform X2 [Cicer arietinum])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|388521053|gb|AFK48588.1| (unknown [Lotus japonicus])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|449444290|ref|XP_004139908.1| (PREDICTED: 50S ribosomal protein L20-like isoform 1 [Cucumis sativus] >gi|449444292|ref|XP_004139909.1| PREDICTED: 50S ribosomal protein L20-like isoform 2 [Cucumis sativus] >gi|449444294|ref|XP_004139910.1| PREDICTED: 50S ribosomal protein L20-like isoform 3 [Cucumis sativus] >gi|449444296|ref|XP_004139911.1| PREDICTED: 50S ribosomal protein L20-like isoform 4 [Cucumis sativus] >gi|449475856|ref|XP_004154571.1| PREDICTED: 50S ribosomal protein L20-like isoform 1 [Cucumis sativus] >gi|449475859|ref|XP_004154572.1| PREDICTED: 50S ribosomal protein L20-like isoform 2 [Cucumis sativus] >gi|449475863|ref|XP_004154573.1| PREDICTED: 50S ribosomal protein L20-like isoform 3 [Cucumis sativus])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|224065238|ref|XP_002301732.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|595877071|ref|XP_007212231.1| (hypothetical protein PRUPE_ppa013387mg [Prunus persica] >gi|595877140|ref|XP_007212232.1| hypothetical protein PRUPE_ppa013387mg [Prunus persica] >gi|596292982|ref|XP_007226592.1| hypothetical protein PRUPE_ppa023673mg [Prunus persica] >gi|462408096|gb|EMJ13430.1| hypothetical protein PRUPE_ppa013387mg [Prunus persica] >gi|462408097|gb|EMJ13431.1| hypothetical protein PRUPE_ppa013387mg [Prunus persica] >gi|462423528|gb|EMJ27791.1| hypothetical protein PRUPE_ppa023673mg [Prunus persica])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|313586591|gb|ADR71306.1| (50S ribosomal protein L20 [Hevea brasiliensis])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|590616648|ref|XP_007023565.1| (Ribosomal protein L20 [Theobroma cacao] >gi|508778931|gb|EOY26187.1| Ribosomal protein L20 [Theobroma cacao])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|255579823|ref|XP_002530749.1| (50S ribosomal protein L20, putative [Ricinus communis] >gi|223529713|gb|EEF31655.1| 50S ribosomal protein L20, putative [Ricinus communis])
BLAST of Medtr0027s0250.1 vs. NCBI nr
Match: gi|460374743|ref|XP_004233169.1| (PREDICTED: 50S ribosomal protein L20-like [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0250.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|351727347|ref|NP_001235366.1|5.164070e-8196.69uncharacterized protein LOC100527387 [Glycine max]... [more]
gi|502098066|ref|XP_004491147.1|1.753700e-8095.87PREDICTED: 50S ribosomal protein L20-like isoform ... [more]
gi|388521053|gb|AFK48588.1|3.850720e-7891.74unknown [Lotus japonicus][more]
gi|449444290|ref|XP_004139908.1|4.145220e-7894.92PREDICTED: 50S ribosomal protein L20-like isoform ... [more]
gi|224065238|ref|XP_002301732.1|7.883420e-7793.39predicted protein [Populus trichocarpa][more]
gi|595877071|ref|XP_007212231.1|1.130050e-7593.22hypothetical protein PRUPE_ppa013387mg [Prunus per... [more]
gi|313586591|gb|ADR71306.1|2.561070e-7590.0850S ribosomal protein L20 [Hevea brasiliensis][more]
gi|590616648|ref|XP_007023565.1|5.031230e-7489.17Ribosomal protein L20 [Theobroma cacao] >gi|508778... [more]
gi|255579823|ref|XP_002530749.1|1.132950e-7391.6050S ribosomal protein L20, putative [Ricinus commu... [more]
gi|460374743|ref|XP_004233169.1|1.945440e-7388.14PREDICTED: 50S ribosomal protein L20-like [Solanum... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005813Ribosomal protein L20PRINTSPR00062RIBOSOMALL20coord: 1..30
score: 9.7e-32coord: 31..60
score: 9.7e-32coord: 64..90
score: 9.7
IPR005813Ribosomal protein L20TIGRFAMsTIGR01032rplT_bact: ribosomal protein L20coord: 5..103
score: 8.9
IPR005813Ribosomal protein L20PROSITEPS00937RIBOSOMAL_L20coord: 43..59
score
NoneNo IPR availablePRODOMPD002389Q65XC7_ORYSA_Q65XC7;coord: 9..61
score: 4
NoneNo IPR availableGENE3D1.10.1900.20no descriptioncoord: 44..105
score: 2
NoneNo IPR availableSUPERFAMILY74731Ribosomal protein L20coord: 50..109
score: 1.5

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0250.1 ID=Medtr0027s0250.1|Name=Medtr0027s0250.1|organism=Medicago truncatula|type=mRNA|length=366bp
ATGAATAAGGATAAGATTTTCAAGTTGGCAAAGGGGTTCAGGGGAAGAGC
AAAGAATTGCATTAGGATTGCTAGGGAGAGGGTGGAGAAGGCGTTGCAGT
ATTCTTACAGGGATCGCCGGAACAAAAAGAGGGACATGCGATCCCTTTGG
ATTCAAAGGATTAATGCTGGCACCCGCATTCATGGTGTCAATTATGGGAA
CTTCATGCATGGGCTGTTGAAGGAGAATATTCAACTTAACAGAAAGGTTT
TGTCAGAGATATCTATGCATGAACCCTATAGTTTCAAGTCATTGGTAGAC
ATATCACGAAATGCATTTCCTGGAAACAAGAATGTGGTTGTCCCTCCAAG
AAAGGTGTCCTTTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005813Ribosomal protein L20
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003735structural constituent of ribosome
GO:0019843rRNA binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005840ribosome
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006412translation
GO:0042254ribosome biogenesis
GO:0000027ribosomal large subunit assembly
GO:0006996organelle organization
GO:0008150biological_process
GO:0009987cellular process
GO:0022607cellular component assembly
GO:0016043cellular component organization
GO:0022613ribonucleoprotein complex biogenesis
GO:0022618ribonucleoprotein complex assembly
GO:0034622cellular macromolecular complex assembly
GO:0042255ribosome assembly
GO:0042273ribosomal large subunit biogenesis
GO:0043933macromolecular complex subunit organization
GO:0044085cellular component biogenesis
GO:0065003macromolecular complex assembly
GO:0070925organelle assembly
GO:0071826ribonucleoprotein complex subunit organization
GO:0071840cellular component organization or biogenesis