Overview
NameMedtr0027s0230.1
Unique NameMedtr0027s0230.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length504
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006979 response to oxidative stress
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00011.16123431-12312062-1651-10280.06.4e-2780.55.8e-23

Homology
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|502103884|ref|XP_004492385.1| (PREDICTED: 17.6 kDa class I heat shock protein-like [Cicer arietinum])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|388509282|gb|AFK42707.1| (unknown [Lotus japonicus])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|356568014|ref|XP_003552209.1| (PREDICTED: 18.1 kDa class I heat shock protein [Glycine max])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|356523225|ref|XP_003530242.1| (PREDICTED: 18.1 kDa class I heat shock protein-like [Glycine max])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|356548686|ref|XP_003542731.1| (PREDICTED: 18.5 kDa class I heat shock protein-like [Glycine max])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|502142727|ref|XP_004505085.1| (PREDICTED: 18.5 kDa class I heat shock protein-like [Cicer arietinum])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|300827456|gb|ADK36668.1| (cytosolic class I small heat shock protein 3B [Nicotiana tabacum])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|356548690|ref|XP_003542733.1| (PREDICTED: 18.5 kDa class I heat shock protein-like [Glycine max])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|300827454|gb|ADK36667.1| (cytosolic class I small heat shock protein 3A [Nicotiana tabacum])
BLAST of Medtr0027s0230.1 vs. NCBI nr
Match: gi|502180002|ref|XP_004516546.1| (PREDICTED: 18.5 kDa class I heat shock protein-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0230.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502103884|ref|XP_004492385.1|5.074050e-9481.66PREDICTED: 17.6 kDa class I heat shock protein-lik... [more]
gi|388509282|gb|AFK42707.1|4.456550e-7570.06unknown [Lotus japonicus][more]
gi|356568014|ref|XP_003552209.1|3.986400e-6767.63PREDICTED: 18.1 kDa class I heat shock protein [Gl... [more]
gi|356523225|ref|XP_003530242.1|2.981590e-5962.72PREDICTED: 18.1 kDa class I heat shock protein-lik... [more]
gi|356548686|ref|XP_003542731.1|1.293750e-4246.06PREDICTED: 18.5 kDa class I heat shock protein-lik... [more]
gi|502142727|ref|XP_004505085.1|4.116570e-4144.85PREDICTED: 18.5 kDa class I heat shock protein-lik... [more]
gi|300827456|gb|ADK36668.1|8.420390e-4145.45cytosolic class I small heat shock protein 3B [Nic... [more]
gi|356548690|ref|XP_003542733.1|3.653820e-4044.24PREDICTED: 18.5 kDa class I heat shock protein-lik... [more]
gi|300827454|gb|ADK36667.1|5.658110e-4044.24cytosolic class I small heat shock protein 3A [Nic... [more]
gi|502180002|ref|XP_004516546.1|6.749750e-4044.85PREDICTED: 18.5 kDa class I heat shock protein-lik... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002068Heat shock protein Hsp20PROFILEPS01031HSP20coord: 62..151
score: 18
IPR008978HSP20-like chaperoneSUPERFAMILY49764HSP20-like chaperonescoord: 17..166
score: 2.2
NoneNo IPR availableGENE3D2.60.40.790no descriptioncoord: 51..165
score: 2.6
NoneNo IPR availableSEGsegsegcoord: 83..93
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0230.1 ID=Medtr0027s0230.1|Name=Medtr0027s0230.1|organism=Medicago truncatula|type=mRNA|length=504bp
ATGTCACTCTTTCCCAATAGCATCTTTGGTCGAAGAAGATCAGAACCAAA
AGATCATCACCAAACATGGCACCACCCATCATACCAAAACCATGGTTATG
GAATTTCTCAAACCAACACACCCCATCATATAACACCACCACCTTTCCAC
AACGAACCATCACCAATTATTAACACTCAAATAGAGTGGAAAGAAACCCA
TGAAGCTCATATCTACAAAGCACACCTTCCGGGGCTGAAACGAAGCGATG
TTCGAGTTGAAGTTGATGAGGATAGAGTTCTATGTATCATTTGTGAGAAA
AGTGTTGAGAAGGAAGAACAAAGAGGAGGGTGGCATAGAGTTGAAGTTGC
TAGTGGTCATTTTGTTCAACGTCTTACCTTGCCTGAAAATTCTAAGGTTG
ATCATGTTAAGGCTTATATGGATAATGGTGTGCTTACTATTCATGTTCCT
AAGCATAGAGTTGGGAACACACGTGTTAGAAATGTTCAAATTTCTCATGT
GTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002068Heat shock protein Hsp20
IPR008978HSP20-like chaperone
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006950response to stress
GO:0006979response to oxidative stress
GO:0008150biological_process
GO:0050896response to stimulus