Overview
NameMedtr0027s0220.1
Unique NameMedtr0027s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length450
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006812 cation transport
biological_process GO:0006825 copper ion transport
biological_process GO:0051234 establishment of localization
biological_process GO:0006811 ion transport
biological_process GO:0051179 localization
biological_process GO:0030001 metal ion transport
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0000041 transition metal ion transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0008324 cation transmembrane transporter activity
molecular_function GO:0005375 copper ion transmembrane transporter activity
molecular_function GO:0022890 inorganic cation transmembrane transporter activity
molecular_function GO:0015075 ion transmembrane transporter activity
molecular_function GO:0046873 metal ion transmembrane transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0046915 transition metal ion transmembrane transporter activity
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF04145.10120417-12028027-721-4736.43.2e-1379.03.2e-22

Homology
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|502103879|ref|XP_004492384.1| (PREDICTED: copper transporter 6-like [Cicer arietinum])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|356566608|ref|XP_003551522.1| (PREDICTED: copper transporter 1-like [Glycine max])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|356523223|ref|XP_003530241.1| (PREDICTED: copper transporter 6-like [Glycine max])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|255587211|ref|XP_002534182.1| (copper transporter, putative [Ricinus communis] >gi|223525742|gb|EEF28206.1| copper transporter, putative [Ricinus communis])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|225440544|ref|XP_002276084.1| (PREDICTED: copper transporter 6 [Vitis vinifera])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|590628944|ref|XP_007026854.1| (Copper transporter, putative [Theobroma cacao] >gi|508715459|gb|EOY07356.1| Copper transporter, putative [Theobroma cacao])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|595838994|ref|XP_007207757.1| (hypothetical protein PRUPE_ppa026783mg [Prunus persica] >gi|462403399|gb|EMJ08956.1| hypothetical protein PRUPE_ppa026783mg [Prunus persica])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|224090831|ref|XP_002309100.1| (copper transporter [Populus trichocarpa])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|595839665|ref|XP_007207881.1| (hypothetical protein PRUPE_ppa021274mg [Prunus persica] >gi|462403523|gb|EMJ09080.1| hypothetical protein PRUPE_ppa021274mg [Prunus persica])
BLAST of Medtr0027s0220.1 vs. NCBI nr
Match: gi|225434744|ref|XP_002280088.1| (PREDICTED: copper transporter 1 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502103879|ref|XP_004492384.1|2.601870e-8687.50PREDICTED: copper transporter 6-like [Cicer arieti... [more]
gi|356566608|ref|XP_003551522.1|2.824110e-7779.73PREDICTED: copper transporter 1-like [Glycine max][more]
gi|356523223|ref|XP_003530241.1|2.772070e-7177.86PREDICTED: copper transporter 6-like [Glycine max][more]
gi|255587211|ref|XP_002534182.1|1.132140e-3752.03copper transporter, putative [Ricinus communis] >g... [more]
gi|225440544|ref|XP_002276084.1|1.870060e-3754.92PREDICTED: copper transporter 6 [Vitis vinifera][more]
gi|590628944|ref|XP_007026854.1|3.698370e-3652.34Copper transporter, putative [Theobroma cacao] >gi... [more]
gi|595838994|ref|XP_007207757.1|8.481820e-3650.72hypothetical protein PRUPE_ppa026783mg [Prunus per... [more]
gi|224090831|ref|XP_002309100.1|8.478010e-3555.17copper transporter [Populus trichocarpa][more]
gi|595839665|ref|XP_007207881.1|2.360660e-3450.00hypothetical protein PRUPE_ppa021274mg [Prunus per... [more]
gi|225434744|ref|XP_002280088.1|1.644510e-3246.43PREDICTED: copper transporter 1 [Vitis vinifera][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 137..148
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0220.1 ID=Medtr0027s0220.1|Name=Medtr0027s0220.1|organism=Medicago truncatula|type=mRNA|length=450bp
ATGTCATTCACCACCACTGCAAACGGTGTTCCTTCCAACTCCACGGTGGC
GATGATGTTGGGCCGGCGAAGAATTCCAATCCACACATCATTCTATTGGG
GTCATAATGTAGACATACTATTCCATTGCTGGCCCGGGGACAGCGCTGTC
ATGTACGCGGTGGCGCTGATCCTCGTGTTTGTAATGTCGTTGTTGGTGGA
GTGGCTTTCATTTACCAATATTGTTAAAGTCAAACCTGGGACATCAAACG
ACGTCGTTGGCTCACTTTTAAGGACGGGCCTGTATGGTGTCCGTACTGGA
TTCTCGTACTTGGTTATGTTGGCTGTTATGTCGTTTAATGGTGGTGTGTT
TCTAGCTGCAATTGGTGGCCATGTTATTGGGTTTATGGTGTTTGGAACAA
TGGCTATTTTGAAGAAATCTAGTGGGTTGGATTCTTCTTCCAAACCATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0000041transition metal ion transport
GO:0006810transport
GO:0006811ion transport
GO:0006812cation transport
GO:0030001metal ion transport
GO:0006825copper ion transport
GO:0008150biological_process
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0051179localization
GO:0051234establishment of localization
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0046873metal ion transmembrane transporter activity
GO:0005215transporter activity
GO:0022857transmembrane transporter activity
GO:0005375copper ion transmembrane transporter activity
GO:0008324cation transmembrane transporter activity
GO:0015075ion transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022890inorganic cation transmembrane transporter activity
GO:0022892substrate-specific transporter activity
GO:0046915transition metal ion transmembrane transporter activity