Overview
NameMedtr0027s0200.1
Unique NameMedtr0027s0200.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length708
Homology
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|502103636|ref|XP_004492330.1| (PREDICTED: uncharacterized protein LOC101498909 [Cicer arietinum])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|255560201|ref|XP_002521118.1| (conserved hypothetical protein [Ricinus communis] >gi|223539687|gb|EEF41269.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|590714082|ref|XP_007049816.1| (Uncharacterized protein isoform 1 [Theobroma cacao] >gi|508702077|gb|EOX93973.1| Uncharacterized protein isoform 1 [Theobroma cacao])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|590714086|ref|XP_007049817.1| (Uncharacterized protein isoform 2, partial [Theobroma cacao] >gi|508702078|gb|EOX93974.1| Uncharacterized protein isoform 2, partial [Theobroma cacao])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|297744300|emb|CBI37270.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|470112312|ref|XP_004292380.1| (PREDICTED: uncharacterized protein LOC101311157 [Fragaria vesca subsp. vesca])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|449468620|ref|XP_004152019.1| (PREDICTED: uncharacterized protein LOC101208427 [Cucumis sativus] >gi|449518256|ref|XP_004166158.1| PREDICTED: uncharacterized LOC101208427 [Cucumis sativus])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|224065316|ref|XP_002301771.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|460393882|ref|XP_004242537.1| (PREDICTED: uncharacterized protein LOC101262531 [Solanum lycopersicum])
BLAST of Medtr0027s0200.1 vs. NCBI nr
Match: gi|595798494|ref|XP_007201395.1| (hypothetical protein PRUPE_ppa012203mg [Prunus persica] >gi|462396795|gb|EMJ02594.1| hypothetical protein PRUPE_ppa012203mg [Prunus persica])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0200.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 13
Match NameE-valueIdentityDescription
gi|502103636|ref|XP_004492330.1|5.591810e-8972.11PREDICTED: uncharacterized protein LOC101498909 [C... [more]
gi|255560201|ref|XP_002521118.1|5.565850e-4048.97conserved hypothetical protein [Ricinus communis] ... [more]
gi|590714082|ref|XP_007049816.1|3.441030e-3243.72Uncharacterized protein isoform 1 [Theobroma cacao... [more]
gi|590714086|ref|XP_007049817.1|4.803030e-3243.96Uncharacterized protein isoform 2, partial [Theobr... [more]
gi|297744300|emb|CBI37270.3|4.645200e-2944.58unnamed protein product [Vitis vinifera][more]
gi|470112312|ref|XP_004292380.1|1.215440e-2639.80PREDICTED: uncharacterized protein LOC101311157 [F... [more]
gi|449468620|ref|XP_004152019.1|2.119000e-2138.66PREDICTED: uncharacterized protein LOC101208427 [C... [more]
gi|224065316|ref|XP_002301771.1|5.511700e-1953.93predicted protein [Populus trichocarpa][more]
gi|460393882|ref|XP_004242537.1|2.093330e-1836.04PREDICTED: uncharacterized protein LOC101262531 [S... [more]
gi|595798494|ref|XP_007201395.1|1.677340e-1556.67hypothetical protein PRUPE_ppa012203mg [Prunus per... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0200.1 ID=Medtr0027s0200.1|Name=Medtr0027s0200.1|organism=Medicago truncatula|type=mRNA|length=708bp
ATGAGGTACTTCAAAGTAACATCTTTGTCGAAATTTCGTCCGAAACAACG
AAAATTTCGCATGGATAGAGAAAAGTGGTCAAAATTTAGGATTCTTCAAT
GGCTCTTTAAAAAGGCACAAGAACAAGAAAGAAAGAGAAGCACCTATATC
AATGAACAAAATGGTAAAGGGAATATTAGTGGACTAAAGCAAGATGGATC
ATATAAAAGGACAAAGAGGTTTTCATGCAGCAAAGATGGTTACAAGAATT
TGAAGATATTCTCTTTACTATATAGAAAAGACATTCCAAAGGCTTGTTTT
TTCAGAACCCTTAGCTTAAAGAGAATAGGCATTAGTAGAAGACATTTTGT
GTACTCTATGAAAATGAAGAAAGAAGAATCATCTAGAGATGAAGGAATTG
TTAACAAGACAGACTCAACAACTCATGGAGGAAACAAGGTTTTGCCTATA
ACTCAAGAAGCACCATTATCATCTTCAGCTGAAAGAAATGACCAATGTGA
TAATACAATAACTAAAGATCAAGTTAAAGGTGATAGAAAGAAGCCTATGT
CTAGAATGAAAGAGTTGCTTAGATGGGCTGCTGCCTCTGCCAAGACAGAT
AAAGGAGGAAAATTCTATGGAAGAAAGCCAAGTTATAATGCCAAATGGTC
CCCTAGCTTAACTAGTAACGACGATATTGTTAGACTAAACACCTTCATTC
AGATTTAA
back to top