Overview
NameMedtr0027s0090.1
Unique NameMedtr0027s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1173
Homology
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|356523219|ref|XP_003530239.1| (PREDICTED: uncharacterized protein LOC100786732 [Glycine max])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|356566594|ref|XP_003551515.1| (PREDICTED: uncharacterized protein LOC100795977 [Glycine max])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|255646925|gb|ACU23932.1| (unknown [Glycine max])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|460401740|ref|XP_004246375.1| (PREDICTED: uncharacterized protein LOC101263742 [Solanum lycopersicum])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|590628968|ref|XP_007026860.1| (Uncharacterized protein TCM_021816 [Theobroma cacao] >gi|508715465|gb|EOY07362.1| Uncharacterized protein TCM_021816 [Theobroma cacao])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|449529164|ref|XP_004171571.1| (PREDICTED: uncharacterized LOC101214270 [Cucumis sativus])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|449460351|ref|XP_004147909.1| (PREDICTED: uncharacterized protein LOC101214270 [Cucumis sativus])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|225440538|ref|XP_002275792.1| (PREDICTED: uncharacterized protein LOC100254537 [Vitis vinifera])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|595824733|ref|XP_007205287.1| (hypothetical protein PRUPE_ppa006609mg [Prunus persica] >gi|462400929|gb|EMJ06486.1| hypothetical protein PRUPE_ppa006609mg [Prunus persica])
BLAST of Medtr0027s0090.1 vs. NCBI nr
Match: gi|470133679|ref|XP_004302688.1| (PREDICTED: uncharacterized protein LOC101303240 [Fragaria vesca subsp. vesca])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356523219|ref|XP_003530239.1|3.241560e-8451.42PREDICTED: uncharacterized protein LOC100786732 [G... [more]
gi|356566594|ref|XP_003551515.1|6.512370e-7647.41PREDICTED: uncharacterized protein LOC100795977 [G... [more]
gi|255646925|gb|ACU23932.1|3.780470e-7050.53unknown [Glycine max][more]
gi|460401740|ref|XP_004246375.1|3.101740e-5137.30PREDICTED: uncharacterized protein LOC101263742 [S... [more]
gi|590628968|ref|XP_007026860.1|1.273530e-4940.91Uncharacterized protein TCM_021816 [Theobroma caca... [more]
gi|449529164|ref|XP_004171571.1|2.069700e-4739.02PREDICTED: uncharacterized LOC101214270 [Cucumis s... [more]
gi|449460351|ref|XP_004147909.1|4.487340e-4739.02PREDICTED: uncharacterized protein LOC101214270 [C... [more]
gi|225440538|ref|XP_002275792.1|5.615350e-4638.53PREDICTED: uncharacterized protein LOC100254537 [V... [more]
gi|595824733|ref|XP_007205287.1|3.166440e-4538.97hypothetical protein PRUPE_ppa006609mg [Prunus per... [more]
gi|470133679|ref|XP_004302688.1|1.209780e-4036.53PREDICTED: uncharacterized protein LOC101303240 [F... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 192..213
score
NoneNo IPR availableSEGsegsegcoord: 99..105
score: NAcoord: 230..241
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0090.1 ID=Medtr0027s0090.1|Name=Medtr0027s0090.1|organism=Medicago truncatula|type=mRNA|length=1173bp
ATGGCTGAAAATTTGGATGACGGTGAGTTCTGGCTTCCGCCGCAGTTTCT
CTCCGACGACGACGGTGATGACACCATCACCACAAAAGCGAAACCTTCTT
CATTTTCGCTTTTCAACAATGGTGAAGATCCTCTGCTTTTTCCTTATGGA
TTCGCTTGCTCTGATCTCAGTTCACCGATCGATTCTCTTGCTGCTTCAAG
CGAAACCGAAAGTGACGATGATGAACAACTCTTCGCTGAGTTAACTCGTT
GCTTGTCTCGTTCCTCTCTCCATGTTGATTCCAAAGCCTCTGAGAATCAT
AACAATAACAATAACTTGGGAGGTTCACCACAATCAACCCTATGTGCTTT
TGACTCCAAATGTCGTAAGGGTTCAAGCCAAGGTAGCTCTAATGGTGTTT
GTGATGCTGCTTCTTCGAATGCTACTCTGAATCTGTTGCATGCTGCTGCT
GGTGAAGTTGAAACATTGAGATTGAATCAACAAACTGTTCCTCAAAGAAA
TTCTTCCCCTGTTACTTTACCCAAAAACAACGCTGTTTCACCAAATGATT
TGAGCTTTTTTGCTCCACAATCAATTTCTCATTATCAATTGCAAATCGCT
AATTTGCAGAGGATGAGGCAGCAACAGATTGCTGAAAGGCTGAACACAAT
AAGGGAGGGTATGCAGAGGCAAAATGGGGGTGTATTTCAGCAAAGACAAA
CAAATGGAAGAAGAAACAACAACGTTGCTGGTTTAGGTCTGTCATCATCT
GCATGGCCAACACTACAACATGCTCAACAACAACAACCACCAATTCACAC
TTCTCCACCATGTTTTCCTATGGGAGCTGTTTTCCATGGAAATGGTTATG
GTAGCAGTACTGGCACTGGTGTGTTCTTACCTCGTCCTGTTGAATCAAGA
AATTCACCAAAAAAACCAGCTTGTACTACTGCATATGTTCCAGCTAGAGT
GGCGCATGCCCTTAACCTAAAGCTTGAAGATTATATAGTGGGGTGCCAGC
CGCATCGTTTTAATTCCACCTCTAATGTTGAAAATGTAGCTGCTGTTGCT
CCTCCAAGGCATAGGGGTAATAATGTCAATTCACAAAAGAAGCGCAGCAA
TAATACTACCAGCAGGCCTCAGCCAGCAGCAGTGAGCAATGAAATCAAGC
TTCCACAGGAGTGGACGTACTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated