Overview
NameMedtr0027s0030.1
Unique NameMedtr0027s0030.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length300
Homology
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|502087157|ref|XP_004488446.1| (PREDICTED: uncharacterized protein LOC101492698 [Cicer arietinum])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|474259114|gb|EMS60458.1| (Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Triticum urartu])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|70664015|emb|CAE04897.3| (OSJNBa0042I15.19 [Oryza sativa Japonica Group])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|89179368|gb|ABD63105.1| (polyprotein-like, related [Asparagus officinalis])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|77556065|gb|ABA98861.1| (retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa Japonica Group])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|77554029|gb|ABA96825.1| (retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa Japonica Group])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|13540823|gb|AAK29467.1| (polyprotein-like [Solanum chilense])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|38344236|emb|CAD41329.2| (OJ991113_30.13 [Oryza sativa Japonica Group])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|377655443|gb|AFB73912.1| (polyprotein [Citrus sinensis])
BLAST of Medtr0027s0030.1 vs. NCBI nr
Match: gi|377655441|gb|AFB73911.1| (polyprotein [Citrus sinensis])
The following BLAST results are available for this feature:
BLAST of Medtr0027s0030.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 18
Match NameE-valueIdentityDescription
gi|502087157|ref|XP_004488446.1|4.850310e-761.90PREDICTED: uncharacterized protein LOC101492698 [C... [more]
gi|474259114|gb|EMS60458.1|1.802030e-635.94Retrovirus-related Pol polyprotein from transposon... [more]
gi|70664015|emb|CAE04897.3|1.895240e-634.18OSJNBa0042I15.19 [Oryza sativa Japonica Group][more]
gi|89179368|gb|ABD63105.1|4.510800e-639.68polyprotein-like, related [Asparagus officinalis][more]
gi|77556065|gb|ABA98861.1|9.115800e-635.94retrotransposon protein, putative, Ty1-copia subcl... [more]
gi|77554029|gb|ABA96825.1|1.564320e-535.94retrotransposon protein, putative, Ty1-copia subcl... [more]
gi|13540823|gb|AAK29467.1|4.574450e-534.31polyprotein-like [Solanum chilense][more]
gi|38344236|emb|CAD41329.2|8.385590e-535.00OJ991113_30.13 [Oryza sativa Japonica Group][more]
gi|377655443|gb|AFB73912.1|1.067530e-432.81polyprotein [Citrus sinensis][more]
gi|377655441|gb|AFB73911.1|1.116780e-432.81polyprotein [Citrus sinensis][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0027s0030.1 ID=Medtr0027s0030.1|Name=Medtr0027s0030.1|organism=Medicago truncatula|type=mRNA|length=300bp
ATGGGTAAGAGCCCTTGTTGTGTTTTCTATTGTTACTATCGCCAAATTGC
CAATGTTGATCTCTCTCGTGTGCAAGCCTCTCATGTTTTGAAAGGAAACA
TTTCCAAGATGGACAATGAGAAGTGGGAGGAACTAGATTTGAGAGCTTTG
AGTACAATCTGCATGTCTTTGGCTAAGAATATTCTTGTGAATGTTCTTGG
CACGTCATCAACCAAGGTGCTTTGGGAGAAACTTGATGAGCTATATAAGG
CAAAGCATGTCTCAAATCAATTATTGTTGAAGGAGAAATTTCATAGCTAA
back to top