Overview
NameMedtr0026s0220.1
Unique NameMedtr0026s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length171
Homology
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|502149092|ref|XP_004507389.1| (PREDICTED: uncharacterized protein LOC101513960 [Cicer arietinum])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|356545333|ref|XP_003541098.1| (PREDICTED: uncharacterized protein LOC100790779 [Glycine max])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|502123604|ref|XP_004498185.1| (PREDICTED: uncharacterized protein LOC101491038 [Cicer arietinum])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|356541113|ref|XP_003539027.1| (PREDICTED: uncharacterized protein LOC100805046 [Glycine max])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|186500670|ref|NP_179203.2| (Cysteine/Histidine-rich C1 domain family protein [Arabidopsis thaliana] >gi|330251368|gb|AEC06462.1| Cysteine/Histidine-rich C1 domain family protein [Arabidopsis thaliana])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|225428584|ref|XP_002284701.1| (PREDICTED: uncharacterized protein LOC100264105 [Vitis vinifera])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|470106548|ref|XP_004289630.1| (PREDICTED: uncharacterized protein LOC101309404 [Fragaria vesca subsp. vesca])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|224077790|ref|XP_002305409.1| (DC1 domain-containing family protein [Populus trichocarpa] >gi|222848373|gb|EEE85920.1| DC1 domain-containing family protein [Populus trichocarpa])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|388497820|gb|AFK36976.1| (unknown [Lotus japonicus])
BLAST of Medtr0026s0220.1 vs. NCBI nr
Match: gi|224105465|ref|XP_002313820.1| (DC1 domain-containing family protein [Populus trichocarpa] >gi|222850228|gb|EEE87775.1| DC1 domain-containing family protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0026s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 11
Match NameE-valueIdentityDescription
gi|502149092|ref|XP_004507389.1|6.976620e-1064.81PREDICTED: uncharacterized protein LOC101513960 [C... [more]
gi|356545333|ref|XP_003541098.1|1.098070e-652.94PREDICTED: uncharacterized protein LOC100790779 [G... [more]
gi|502123604|ref|XP_004498185.1|1.784760e-652.73PREDICTED: uncharacterized protein LOC101491038 [C... [more]
gi|356541113|ref|XP_003539027.1|4.372370e-650.98PREDICTED: uncharacterized protein LOC100805046 [G... [more]
gi|186500670|ref|NP_179203.2|3.006940e-556.25Cysteine/Histidine-rich C1 domain family protein [... [more]
gi|225428584|ref|XP_002284701.1|3.663630e-580.77PREDICTED: uncharacterized protein LOC100264105 [V... [more]
gi|470106548|ref|XP_004289630.1|4.963910e-580.77PREDICTED: uncharacterized protein LOC101309404 [F... [more]
gi|224077790|ref|XP_002305409.1|7.660430e-553.33DC1 domain-containing family protein [Populus tric... [more]
gi|388497820|gb|AFK36976.1|1.186660e-448.15unknown [Lotus japonicus][more]
gi|224105465|ref|XP_002313820.1|1.444950e-451.11DC1 domain-containing family protein [Populus tric... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0026s0220.1 ID=Medtr0026s0220.1|Name=Medtr0026s0220.1|organism=Medicago truncatula|type=mRNA|length=171bp
ATGACTATTGGTGTGAGATATTGGAATATGATAGTTAGGGCGTTACACGC
TGCACATAATTGCAGAGGAAGTAGAGGAAGTAAAGGAAAGAAGATTGTGA
TTTCAGCGGTTTTGGGTGATCCTACGACTCTCATTGCTGGTGTTGTTGGG
GCGCTCATGTCTAGGGCTTGA
back to top