Overview
NameMedtr0026s0210.1
Unique NameMedtr0026s0210.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1050
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0015671 oxygen transport
biological_process GO:0006979 response to oxidative stress
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
molecular_function GO:0016209 antioxidant activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0020037 heme binding
molecular_function GO:0005506 iron ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0016491 oxidoreductase activity
molecular_function GO:0016684 oxidoreductase activity, acting on peroxide as acceptor
molecular_function GO:0019825 oxygen binding
molecular_function GO:0004601 peroxidase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00042.17100614-100943189-2981-10867.76.2e-23123.53.9e-36

Homology
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|363807980|ref|NP_001242203.1| (uncharacterized protein LOC100809295 [Glycine max] >gi|255647060|gb|ACU23998.1| unknown [Glycine max])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|377643998|gb|AFB70892.1| (non-symbiotic hemoglobin [Vigna radiata])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|571488357|ref|XP_006590912.1| (PREDICTED: non-symbiotic hemoglobin 1-like [Glycine max] >gi|1276977|gb|AAA97887.1| nonsymbiotic hemoglobin [Glycine max] >gi|255640909|gb|ACU20737.1| unknown [Glycine max])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|22001646|sp|Q9FVL0.1|HBL1_MEDSA (RecName: Full=Non-symbiotic hemoglobin 1; AltName: Full=MEDsa GLB1 >gi|11095158|gb|AAG29748.1|AF172172_1 non-symbiotic hemoglobin [Medicago sativa])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|502149202|ref|XP_004507433.1| (PREDICTED: plastid division protein PDV2-like [Cicer arietinum])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|62548111|gb|AAX86687.1| (non-symbiotic hemoglobin protein [Gossypium hirsutum])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|37903668|gb|AAP57677.1| (non-symbiotic hemoglobin class 1 [Pyrus communis])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|77799656|dbj|BAE46740.1| (nonsymbiotic hemoglobin [Lotus japonicus] >gi|388492708|gb|AFK34420.1| unknown [Lotus japonicus] >gi|388519715|gb|AFK47919.1| unknown [Lotus japonicus])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|356541111|ref|XP_003539026.1| (PREDICTED: plastid division protein PDV2-like [Glycine max])
BLAST of Medtr0026s0210.1 vs. NCBI nr
Match: gi|22001643|sp|Q947C5.1|HBL1_GOSHI (RecName: Full=Non-symbiotic hemoglobin 1; AltName: Full=GOShi GLB1; Short=Hb1 >gi|15824736|gb|AAL09463.1|AF329368_1 non-symbiotic hemoglobin class 1 [Gossypium hirsutum])
The following BLAST results are available for this feature:
BLAST of Medtr0026s0210.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|363807980|ref|NP_001242203.1|2.744180e-8282.67uncharacterized protein LOC100809295 [Glycine max]... [more]
gi|377643998|gb|AFB70892.1|3.377220e-8278.85non-symbiotic hemoglobin [Vigna radiata][more]
gi|571488357|ref|XP_006590912.1|4.193210e-8278.21PREDICTED: non-symbiotic hemoglobin 1-like [Glycin... [more]
gi|22001646|sp|Q9FVL0.1|HBL1_MEDSA1.658690e-8081.33RecName: Full=Non-symbiotic hemoglobin 1; AltName:... [more]
gi|502149202|ref|XP_004507433.1|6.012310e-8080.00PREDICTED: plastid division protein PDV2-like [Cic... [more]
gi|62548111|gb|AAX86687.1|1.491590e-7977.71non-symbiotic hemoglobin protein [Gossypium hirsut... [more]
gi|37903668|gb|AAP57677.1|1.605930e-7977.63non-symbiotic hemoglobin class 1 [Pyrus communis][more]
gi|77799656|dbj|BAE46740.1|1.810720e-7976.54nonsymbiotic hemoglobin [Lotus japonicus] >gi|3884... [more]
gi|356541111|ref|XP_003539026.1|8.700280e-7978.21PREDICTED: plastid division protein PDV2-like [Gly... [more]
gi|22001643|sp|Q947C5.1|HBL1_GOSHI9.371260e-7977.07RecName: Full=Non-symbiotic hemoglobin 1; AltName:... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000971Globin, subsetPROFILEPS01033GLOBINcoord: 12..162
score: 25.397coord: 185..333
score: 28
IPR001032LeghaemoglobinPRINTSPR00188PLANTGLOBINcoord: 186..203
score: 2.5e-41coord: 211..231
score: 2.5e-41coord: 239..267
score: 2.5e-41coord: 304..330
score: 2.5
IPR009050Globin-likeSUPERFAMILY46458Globin-likecoord: 173..336
score: 8.2e-42coord: 2..165
score: 1.3
IPR012292GlobinGENE3D1.10.490.10no descriptioncoord: 13..163
score: 2e-39coord: 185..334
score: 4.9
IPR019824Leghaemoglobin, iron-binding sitePROSITEPS00208PLANT_GLOBINcoord: 68..79
score: NAcoord: 239..250
score
NoneNo IPR availableCOILcoilcoiled-coilcoord: 154..175
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0026s0210.1 ID=Medtr0026s0210.1|Name=Medtr0026s0210.1|organism=Medicago truncatula|type=mRNA|length=1050bp
ATGGAAGAGAACAAGAAAACTATGGAGAAAAGTGTTGGTTTCACAGAAGA
GCAAGATGCTCTAGTGGTAAAATCATGGAATGCAATGAAGAAAAATTCTG
GGGACCTGAGTCTCAAGTTTTTCAAGAAAATACTGGAGATTGCTCCACCA
GCTAAACAAATGTTTTCATTCTTAAAAGATTCAAATGTCCCTTTGGAACA
TAATCCTAAGCTCAAGCCACATGCTATGTCTGTCTTTCTCATGACATGTG
AGTCAGCAGTTCAACTGCGCAAGGCTGGAAAAGTCACAGTCAGAGAATCA
AATTTGAAGAAATTAGGTGCCACTCATTTCAAAACTGGTGTACAAGATGA
ACATTTTGAGGTAACAAAACAAGCTCTTTTGGAGACAATAGAAGAAGCAA
TACCAGAAATGTGGTATCCAGCTATGAAAAATGCATGGGCAGAAGCTCAT
GATCGGCTGGCCAATGCCATCAAAGCTGAAATGAAAGAAGCTCATGATCA
ACTGGACAGTGCCAATTTGATAATTAACATGGAAGAGAACACAGGCAGTT
GTTTCACCGAGGAACAAGAAGCTCTAGTGGTGAAGTCATGGAATGCAATC
AAGAACAACTCAGAAGATCTGAGTCTCAAGTTTTTCAAGAGAATTTTTGA
GATTGCTCCACCAGCTAAGCAACTATTCTCATTCTTAAGAGATTCAAATG
TTCCTTTGGAGCAAAATCCTAAGCTCAAGCCTCATGCCATGTCTGTCTTT
CTCATGACATGTGAATCAGCAGTTCAACTGAGGAAGGCTGGCAAAGTAAC
TGTTAGTGAATCAAACTTGAAGAAGTTAGGTGCCACTCATTTTAAATCTG
GTGTAAAAGATGAGCATTTTGAGGTAACAAAGCAAGTCCTTTTGGAGACC
ATAAAAGAAGCATTACCTGAAATGTGGTCACCAGCTATGGAAAATGCATG
GGGAGAAGCTCATGATCAACTCGCCAATGCCATCAAAGCTGAAATGAAAA
AAGCTGATCATGATCATCAGGCCAATGTTGAAGACAAACCCTCCTCTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000971Globin, subset
IPR001032Leghaemoglobin
IPR009050Globin-like
IPR012292Globin
IPR019824Leghaemoglobin, iron-binding site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005506iron ion binding
GO:0020037heme binding
GO:0019825oxygen binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004601peroxidase activity
GO:0016491oxidoreductase activity
GO:0016209antioxidant activity
GO:0016684oxidoreductase activity, acting on peroxide as acceptor
Vocabulary: Biological Process
TermDefinition
GO:0015671oxygen transport
GO:0006950response to stress
GO:0006979response to oxidative stress
GO:0008150biological_process
GO:0050896response to stimulus
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0016020membrane