Overview
NameMedtr0026s0200.1
Unique NameMedtr0026s0200.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2337
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0016070 RNA metabolic process
biological_process GO:0009451 RNA modification
biological_process GO:0008150 biological_process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0043412 macromolecule modification
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
molecular_function GO:0004016 adenylate cyclase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009975 cyclase activity
molecular_function GO:0016829 lyase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016849 phosphorus-oxygen lyase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01535.1596344-96433422-4512-3123.77.8e-09120.05e-36
PF12854.296329-96418417-4464-3324.63.3e-09153.46.3e-46
PF13041.196125-96268349-3963-5030.76e-11166.86.3e-50
PF13812.196020-96100314-3401-2714.96.3e-0678.21.1e-22

Homology
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|356538835|ref|XP_003537906.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Glycine max])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|225428586|ref|XP_002281132.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Vitis vinifera])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|590682586|ref|XP_007041384.1| (Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao] >gi|590682590|ref|XP_007041385.1| Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao] >gi|590682593|ref|XP_007041386.1| Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao] >gi|508705319|gb|EOX97215.1| Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao] >gi|508705320|gb|EOX97216.1| Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao] >gi|508705321|gb|EOX97217.1| Tetratricopeptide repeat (TPR)-like superfamily protein, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|595792111|ref|XP_007199804.1| (hypothetical protein PRUPE_ppa004794mg [Prunus persica] >gi|462395204|gb|EMJ01003.1| hypothetical protein PRUPE_ppa004794mg [Prunus persica])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|502149199|ref|XP_004507432.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Cicer arietinum])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|470107001|ref|XP_004289840.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|449502417|ref|XP_004161634.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Cucumis sativus])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|449455312|ref|XP_004145397.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Cucumis sativus] >gi|449472579|ref|XP_004153637.1| PREDICTED: pentatricopeptide repeat-containing protein At2g15980-like [Cucumis sativus])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|224080263|ref|XP_002306075.1| (pentatricopeptide repeat-containing family protein [Populus trichocarpa] >gi|222849039|gb|EEE86586.1| pentatricopeptide repeat-containing family protein [Populus trichocarpa])
BLAST of Medtr0026s0200.1 vs. NCBI nr
Match: gi|255556157|ref|XP_002519113.1| (pentatricopeptide repeat-containing protein, putative [Ricinus communis] >gi|223541776|gb|EEF43324.1| pentatricopeptide repeat-containing protein, putative [Ricinus communis])
The following BLAST results are available for this feature:
BLAST of Medtr0026s0200.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356538835|ref|XP_003537906.1|0.000000e+063.51PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|225428586|ref|XP_002281132.1|6.555590e-17158.72PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|590682586|ref|XP_007041384.1|9.914950e-16354.36Tetratricopeptide repeat (TPR)-like superfamily pr... [more]
gi|595792111|ref|XP_007199804.1|3.735280e-16253.29hypothetical protein PRUPE_ppa004794mg [Prunus per... [more]
gi|502149199|ref|XP_004507432.1|2.639430e-15471.75PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|470107001|ref|XP_004289840.1|5.033480e-15453.23PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|449502417|ref|XP_004161634.1|2.519040e-14851.94PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|449455312|ref|XP_004145397.1|2.349420e-14751.48PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|224080263|ref|XP_002306075.1|6.067100e-14652.55pentatricopeptide repeat-containing family protein... [more]
gi|255556157|ref|XP_002519113.1|1.810590e-14049.14pentatricopeptide repeat-containing protein, putat... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002885Pentatricopeptide repeatTIGRFAMsTIGR00756PPR: pentatricopeptide repeat domaincoord: 157..191
score: 0.079coord: 245..279
score: 2.9e-08coord: 280..314
score: 2.2e-08coord: 315..349
score: 2.6e-07coord: 350..384
score: 1.6e-06coord: 385..420
score: 0.93coord: 421..455
score: 6.8
IPR002885Pentatricopeptide repeatPROFILEPS51375PPRcoord: 101..135
score: 5.437coord: 155..189
score: 7.947coord: 190..224
score: 5.404coord: 243..277
score: 11.718coord: 278..312
score: 11.389coord: 313..347
score: 11.488coord: 348..382
score: 10.424coord: 419..453
score: 10.633coord: 383..418
score: 8
NoneNo IPR availableCOILcoilcoiled-coilcoord: 570..591
score
NoneNo IPR availableSEGsegsegcoord: 168..180
score: NAcoord: 552..562
score: NAcoord: 612..623
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0026s0200.1 ID=Medtr0026s0200.1|Name=Medtr0026s0200.1|organism=Medicago truncatula|type=mRNA|length=2337bp
ATGACAATTCAAGTTCAAGTAGCCAAACTCCTACACCAACCTCTAAAACC
AAATCCAAAAAAAATTCATGTAACCCTCTTCTTCTCCACTTCTTCATCTG
AACAAGAAACTCTCATAACCACCGCTGTCTCCATCCTCACAAACCACCGT
TCGAAATCCCGTTGGAACACACTCCACACCCTCTACCCAAACACCCTCCC
CTCCACCGATTTCTCCCAAATTACACTCCACCTCAAAAACAAACCCCACC
TCGCTCTTCACTTTTATCAATGGACACAATCCAAATCCCTCTGTCACCAC
AACCTCTCCTCTTACTCCACCATCATCCACATCCTCGCACGTGCCCGTCT
CCACTCACACGCTTACAACACCATCAAAACCGCCCTTATCAATGACGATT
CATCTTCCACGCCTTTGAAGTTATTCGAGATTCTTGTTAATTCTTATCGT
GATTGTGGGTCTGCTCCGTTTGTGTTTGATTTATTGATCGAGGTGTGTTT
GGAGTCTAGAAAAATTGAATCTTCAATTGAGATTAGTAGAATGTTGTTAT
CTCGTGGGATTAGTCCTAAAGTTGCTACATTGAATAATTTGATTTCTAGG
GTTTGTAGAAAATTTGGGGTGGATGTTGGGTTTGAGATTTATCGTGAGTT
TTTTCGGTTGGATAAGGAAAAAGATGAAATTTCGAAAAGGGGTTATGGGT
TTAGAGGTTTTAGAGTTGTTAAACCTAATGTACATAGTTTTAATACATTA
ATGTTATGTTGTTATCAAAGTGGCTTGGTTGAGAAAGTTGAGGAAATTTG
GAATGAAATGAGTGAAATGGGTTGTGATCCTAATGCTTACAGTTATAGTT
TACTGATTGCTGCGTTTTGTGATGGAGGGAGAATGGAAGATTGTGAGAAG
ATGTGGGAAAAAATGAGGAAGAAAGAAATTGAGGCTGATGTGGTTAGTTA
TAATACTATAATTGGTGGGTTTTGTAAGATTGGTGATGTTGGAAGAGCTG
AAGAGTTTTATAGAGAAATGGGATTGGTTGGTATTGATGCAACTGTTTCA
ACTTATGAGCATCTTGTTAAGGGGTATTGTGGTATTGAGGATGTTGAATC
AGCTGTTCTTGTTTACAAGGATATGCTTAGGAAGGATTTCAGACCTGATG
CGTCGACGCTTGATATGGTGGTTAGGTTACTTTGTAATAAGGGTAGGGTT
GAGGAAGCTATGAAGTTTTTGAGGAGTGGAGTTGGTAAGTTTGATTTGGT
TCCAAAGGAGAAGAGCTATGAGGCCTTGATTAAGGGGTTTTGTTTTGAGG
GGAGGATGGATGAGGCATTGAAGCTTCAGGCAGAGATGATAGGAAAAGGG
TTTCAATTGAATTCGGAAATATATGAAGTTTTTATTGATGGACAACTAAT
GCGACCAGAGCAGGTTCAGCAGCAAACTTCTGCTGCTGTCATGGTTCCTT
GGGAACCTCCAAGCACATTTGTAGTGACACAATCAGACTGTTGTGAAGCG
GACTTTGTCAGATCCAAAGAAATCAACCACCACATCTCAGCTGTAACTTC
TTCTGAGATCGAGGTGGCGGCTGATTTATCTTCATCCAAGGCTGCTGCTG
TTGATATTTTACGATTTTACCCACCCTTACCAATTAAACGTAAAATCGCG
ATTTTGACTACCTTGCTTGTTCTGCAACAACAGCAGCGGTACGAAAGAGA
AATTGCCTTGGCTGAGATTGAAAACAGTCGCAAAGTGTTAATTAAAAAGC
TCAAGGAGTATAAAGGAAAAGATTTGGAAGTGATACATGAAGCTTCCACT
TTTGCCAGTGAAACTGTGGAGCCAACCAATGATCTACTACTTCCTCCTTA
TCCAACCCGCCCTCCCTATTCCATGTCTCTTGACAAGCAATATCTTTCAC
AGATCCCTTCTGTCAATAAGTCCGGTTGCAATGGATTAATCACACTTGAT
AACGTAATCGATGCTAAAAAGAATCCAAATGAAAAAGAGCAAAATCATGT
TGAAGATGGGGCTAAAAATTCAAGAAAAGGTTTACGATTTTTTATAACTT
CTGCAGCAAAAGCAGTGGTCACAGTTATTGGTGTGGTATCAATATTGAGT
ATGTCAGGATTTGGTCCTAATTTGCTGAAGAATCGTTGGAATGTACAACG
CAGGCATCACAGACTAGAAAATGAGAATGGGAGATCTACCAGTGAAAATA
AGGGTGATGGACAGTGTCCACCTGGTAGAGTTTTGGTGCTGGAAAATGGC
GAGGCTCGATGTCTTGTGAAAGAGAGAGTTGAAATTCCATTTTCAGCTGT
TGCTGCAACACCTGATATAAACTATGGATGTGGTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002885Pentatricopeptide repeat
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0016020membrane
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0009451RNA modification
GO:0009987cellular process
GO:0016070RNA metabolic process
GO:0034641cellular nitrogen compound metabolic process
GO:0043170macromolecule metabolic process
GO:0043412macromolecule modification
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044260cellular macromolecule metabolic process
GO:0046483heterocycle metabolic process
GO:0071704organic substance metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004016adenylate cyclase activity
GO:0009975cyclase activity
GO:0016829lyase activity
GO:0016849phosphorus-oxygen lyase activity