Overview
NameMedtr0026s0160.1
Unique NameMedtr0026s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1473
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0048366 leaf development
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0048513 organ development
biological_process GO:0048827 phyllome development
biological_process GO:0007205 protein kinase C-activating G-protein coupled receptor signaling pathway
biological_process GO:0048364 root development
biological_process GO:0022622 root system development
biological_process GO:0048367 shoot system development
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
biological_process GO:0048731 system development
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0005488 binding
molecular_function GO:0003824 catalytic activity
molecular_function GO:0004143 diacylglycerol kinase activity
molecular_function GO:0016301 kinase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016773 phosphotransferase activity, alcohol group as acceptor
molecular_function GO:0005515 protein binding
molecular_function GO:0016740 transferase activity
molecular_function GO:0016772 transferase activity, transferring phosphorus-containing groups
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00609.1487498-86965285-4621-161159.78e-51160.24e-47
PF00781.1988071-8763494-2392-13087.56.2e-2988.52.1e-25

Homology
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|502178829|ref|XP_004516327.1| (PREDICTED: diacylglycerol kinase epsilon-like [Cicer arietinum])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|356567686|ref|XP_003552048.1| (PREDICTED: diacylglycerol kinase 7-like [Glycine max])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|356517024|ref|XP_003527190.1| (PREDICTED: diacylglycerol kinase 3-like [Glycine max])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|356562487|ref|XP_003549502.1| (PREDICTED: probable diacylglycerol kinase 3-like [Glycine max])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|356547779|ref|XP_003542286.1| (PREDICTED: diacylglycerol kinase 7-like [Glycine max])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|596138853|ref|XP_007222391.1| (hypothetical protein PRUPE_ppa004883mg [Prunus persica] >gi|462419327|gb|EMJ23590.1| hypothetical protein PRUPE_ppa004883mg [Prunus persica])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|502150142|ref|XP_004507809.1| (PREDICTED: probable diacylglycerol kinase 3-like [Cicer arietinum])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|470120687|ref|XP_004296425.1| (PREDICTED: diacylglycerol kinase iota-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|359485049|ref|XP_002271984.2| (PREDICTED: diacylglycerol kinase A-like [Vitis vinifera] >gi|297735318|emb|CBI17758.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0026s0160.1 vs. NCBI nr
Match: gi|224143809|ref|XP_002325082.1| (diacylglycerol kinase family protein [Populus trichocarpa] >gi|222866516|gb|EEF03647.1| diacylglycerol kinase family protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0026s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502178829|ref|XP_004516327.1|0.000000e+089.33PREDICTED: diacylglycerol kinase epsilon-like [Cic... [more]
gi|356567686|ref|XP_003552048.1|0.000000e+081.71PREDICTED: diacylglycerol kinase 7-like [Glycine m... [more]
gi|356517024|ref|XP_003527190.1|0.000000e+080.24PREDICTED: diacylglycerol kinase 3-like [Glycine m... [more]
gi|356562487|ref|XP_003549502.1|0.000000e+079.38PREDICTED: probable diacylglycerol kinase 3-like [... [more]
gi|356547779|ref|XP_003542286.1|0.000000e+079.33PREDICTED: diacylglycerol kinase 7-like [Glycine m... [more]
gi|596138853|ref|XP_007222391.1|0.000000e+075.45hypothetical protein PRUPE_ppa004883mg [Prunus per... [more]
gi|502150142|ref|XP_004507809.1|0.000000e+077.87PREDICTED: probable diacylglycerol kinase 3-like [... [more]
gi|470120687|ref|XP_004296425.1|0.000000e+074.15PREDICTED: diacylglycerol kinase iota-like [Fragar... [more]
gi|359485049|ref|XP_002271984.2|0.000000e+075.10PREDICTED: diacylglycerol kinase A-like [Vitis vin... [more]
gi|224143809|ref|XP_002325082.1|0.000000e+072.97diacylglycerol kinase family protein [Populus tric... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000756Diacylglycerol kinase, accessory domainSMARTSM00045no descriptioncoord: 285..462
score: 6.2
IPR001206Diacylglycerol kinase, catalytic domainSMARTSM00046no descriptioncoord: 93..239
score: 2.7
IPR001206Diacylglycerol kinase, catalytic domainPROFILEPS50146DAGKcoord: 89..246
score: 29
IPR016961Diacylglycerol kinase, plantPIRPIRSF030829Diacylglycerol kinase, plant typecoord: 1..490
score: 3.8e
NoneNo IPR availableSEGsegsegcoord: 3..15
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0026s0160.1 ID=Medtr0026s0160.1|Name=Medtr0026s0160.1|organism=Medicago truncatula|type=mRNA|length=1473bp
ATGGACTCACCATCATCGTCATCGTCGTCGTCGACAACAACGACGGGAGA
TGCGACCAAGTTAGCAGCTGCAAGATCCTCAATTGTCGACTCGATAAGAG
GATGCGGCATTTCAGGTCAGCGCATCGACAAGGAGGAGCTAAAGAGGAAT
CTCACAATGCCGCAGTATCTACGGATATCAATGCGTGATTCAATCCGGTT
GAAGGATCCAACAGCAGGCGAGTTTGGCTTTGGCTTCATTCGTGCCGAGG
AAAGCGCCGCCGTTGCTCCTCTTAAGCCCATTGTTGTTTTCATTAATCCC
CGTAGTGGCGGTCGCCATGGTCCCGTTCTCAAGGAGAGGCTCCAGGATCT
CATGAGTGAGGAACAGGTTTTTGATGTAATAGATGTGAATCCTCGTGAAT
TTCTCCAGTATGGTTTAGGTTGCTTGGAGGCATTGGCTGCTTCTGGTGAC
ACTTGTGCGAAAGAAACACGCGAAAGAATAAGGATAATGGTTGCGGGAGG
TGATGGTTCAGTTGGTTGGGTTTTAGGATGTCTCACTGAACTTAACAAAC
AAGGTCGGGAACCAGTTCCTCCTGTTGGAATCATACCACTTGGTACAGGA
AATGACCTGTCTAGGTGTTTTGGTTGGGGTGGTTCATTTCCATTTGCATG
GAAAGCGGCTATTAAGAGAACTCTTCACAAGGCTAGTATTGGTCCAATTT
GTCGTTTGGATAGTTGGCGAGTTTCACTTTCAATGCCAGAAGGCACAATT
GTGGCACCACCTTATTCTCTAAAGCAGACAGAAGAGTTCATTCTTGATGA
GGGCTTAGAAGTTGAGGGAGAACTGCCTGAGAAAGTTATATGTTATGAAG
GCGTGTTCTACAATTACTTTAGCATAGGAATGGATGCCCAAGTGGCTTAT
GGCTTTCATCATCTTCGTAATGAAAAACCTTACCTTGCCCAGGGACCAAT
AGCAAATAAGATTATATACTCTGGTTATACTTGCACTCAGGGTTGGTTCT
TCACACCTTGTACAAGTGAACCAGGTTTAAGGGGACTTAAGAACATTCTG
CGGATGCATGTCAAAAGGATCAATTGCTCTGAATGGGAGCTGGTTCCAGT
TCCTACAAGCGTAAGGGCAGTAGTTGCTCTGAATCTTCATAGTTATGGAA
GCGGAAGAAATCCATGGGGTAATCTGAAACCAGAATATTTGGAAAAGAGA
GGCTTTGTTGAAGCACAAGTTGATGATGGACTTTTGGAAATATTTGGTCT
AAAGCAAGGATGGCATGCATCATTTGTGATGGTTGAACTGATCTCTGCAA
AGCACATAGCTCAGGCAACAGCTATCCGGTTGGAAGTAAGAGGAGGGGAG
TGGAAAGATGCATATATGCAAATGGATGGTGAACCTTGGAAGCAACCATT
GAGCAAGGACTTCTCAACATTTGTGGAAATAAGGAGGGAACCTTTCCAGT
CACTCATGATTAGTGGAGATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000756Diacylglycerol kinase, accessory domain
IPR001206Diacylglycerol kinase, catalytic domain
IPR016961Diacylglycerol kinase, plant
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004143diacylglycerol kinase activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0005488binding
GO:0016301kinase activity
GO:0016740transferase activity
GO:0016772transferase activity, transferring phosphorus-containing groups
GO:0016773phosphotransferase activity, alcohol group as acceptor
Vocabulary: Biological Process
TermDefinition
GO:0007205protein kinase C-activating G-protein coupled receptor signaling pathway
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0022622root system development
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048364root development
GO:0048366leaf development
GO:0048367shoot system development
GO:0048513organ development
GO:0048731system development
GO:0048827phyllome development
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part