Overview
NameMedtr0026s0010.1
Unique NameMedtr0026s0010.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length504
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF14299.16106-568122-1632-15162.42e-2162.91.8e-17

Homology
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|502178831|ref|XP_004516328.1| (PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like [Cicer arietinum])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|525313927|ref|NP_001265911.1| (protein PHLOEM PROTEIN 2-LIKE A9-like [Cicer arietinum] >gi|6850934|emb|CAB71030.1| lectin-like protein [Cicer arietinum])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|388513459|gb|AFK44791.1| (unknown [Lotus japonicus])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|351727529|ref|NP_001236140.1| (lectin [Glycine max] >gi|4995205|emb|CAB44031.1| lectin [Glycine max])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|255626319|gb|ACU13504.1| (unknown [Glycine max])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|470115112|ref|XP_004293747.1| (PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like isoform 2 [Fragaria vesca subsp. vesca])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|470115110|ref|XP_004293746.1| (PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like isoform 1 [Fragaria vesca subsp. vesca])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|590621975|ref|XP_007024920.1| (Phloem protein 2-A10, putative [Theobroma cacao] >gi|508780286|gb|EOY27542.1| Phloem protein 2-A10, putative [Theobroma cacao])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|595874632|ref|XP_007212125.1| (hypothetical protein PRUPE_ppa012071mg [Prunus persica] >gi|462407990|gb|EMJ13324.1| hypothetical protein PRUPE_ppa012071mg [Prunus persica])
BLAST of Medtr0026s0010.1 vs. NCBI nr
Match: gi|590621942|ref|XP_007024911.1| (Phloem protein 2, putative isoform 1 [Theobroma cacao] >gi|508780277|gb|EOY27533.1| Phloem protein 2, putative isoform 1 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0026s0010.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502178831|ref|XP_004516328.1|7.110950e-6768.67PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like [... [more]
gi|525313927|ref|NP_001265911.1|1.426330e-6568.07protein PHLOEM PROTEIN 2-LIKE A9-like [Cicer ariet... [more]
gi|388513459|gb|AFK44791.1|1.590760e-5558.18unknown [Lotus japonicus][more]
gi|351727529|ref|NP_001236140.1|2.581870e-5057.32lectin [Glycine max] >gi|4995205|emb|CAB44031.1| l... [more]
gi|255626319|gb|ACU13504.1|5.936180e-5057.32unknown [Glycine max][more]
gi|470115112|ref|XP_004293747.1|7.988770e-4852.63PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like i... [more]
gi|470115110|ref|XP_004293746.1|6.702230e-4556.85PREDICTED: protein PHLOEM PROTEIN 2-LIKE A9-like i... [more]
gi|590621975|ref|XP_007024920.1|1.826250e-3844.71Phloem protein 2-A10, putative [Theobroma cacao] >... [more]
gi|595874632|ref|XP_007212125.1|7.015530e-3843.82hypothetical protein PRUPE_ppa012071mg [Prunus per... [more]
gi|590621942|ref|XP_007024911.1|4.591220e-3641.71Phloem protein 2, putative isoform 1 [Theobroma ca... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0026s0010.1 ID=Medtr0026s0010.1|Name=Medtr0026s0010.1|organism=Medicago truncatula|type=mRNA|length=504bp
ATGCCTTTCAGAAAGCCTCATCAGACAGCAGACCCTACTGAGTCTAATAA
ATGGAATGATGCCAAAACTGAGTGCATGATACAGCCAAAAGGACTCAACA
TTATATGGGGAAATGATCCTCGTTACTGGAAAATAACAAATGACTGTGCA
GAACTGATACAAGTTTCATGGTTGGAGGTATCTGGTAAAGTAAAAGTAGA
GAAAGGGAATACATACATAGTGAAATTTATGGTGGAAGTTAAGCAAGATG
GTTTCGGTTGGGGAAGCACAGATGTACTTGTGATGGCTAAAGTTGGGAAA
AAGGGATTATATAAATATGAGGCAGTGAAACTAGATTGTGGTAAAAAAAA
AGACCCCATTCCAGAAGTTAAGGATAAGCTTGAAATTGAGGTGAAAAGTG
ATGAAACAGATCTTGAACTTCATTTTGGATTGTATGAAGTTTGGAGTGGA
AAATGGAAAGGAGGTTTGAAAATCTACAATGCAGAAGTTGTTAAGAAGTC
TTAA
back to top