Overview
NameMedtr0025s0110.1
Unique NameMedtr0025s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1581
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0055114 oxidation-reduction process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009055 electron carrier activity
molecular_function GO:0020037 heme binding
molecular_function GO:0005506 iron ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0004497 monooxygenase activity
molecular_function GO:0016491 oxidoreductase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00067.1767142-6590793-50423-442265.35.1e-83265.85e-79

Homology
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|502119263|ref|XP_004496558.1| (PREDICTED: cytokinin hydroxylase-like [Cicer arietinum])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356574497|ref|XP_003555383.1| (PREDICTED: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356534131|ref|XP_003535611.1| (PREDICTED: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356575971|ref|XP_003556109.1| (PREDICTED: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356534133|ref|XP_003535612.1| (PREDICTED: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356561544|ref|XP_003549041.1| (PREDICTED: LOW QUALITY PROTEIN: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|356529204|ref|XP_003533186.1| (PREDICTED: cytokinin hydroxylase-like [Glycine max])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|224134853|ref|XP_002321921.1| (hypothetical protein POPTR_0015s13020g [Populus trichocarpa] >gi|222868917|gb|EEF06048.1| hypothetical protein POPTR_0015s13020g [Populus trichocarpa])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|596053274|ref|XP_007220755.1| (hypothetical protein PRUPE_ppa024029mg [Prunus persica] >gi|462417217|gb|EMJ21954.1| hypothetical protein PRUPE_ppa024029mg [Prunus persica])
BLAST of Medtr0025s0110.1 vs. NCBI nr
Match: gi|470147201|ref|XP_004309204.1| (PREDICTED: cytochrome P450 734A1-like [Fragaria vesca subsp. vesca])
The following BLAST results are available for this feature:
BLAST of Medtr0025s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502119263|ref|XP_004496558.1|0.000000e+069.86PREDICTED: cytokinin hydroxylase-like [Cicer ariet... [more]
gi|356574497|ref|XP_003555383.1|0.000000e+069.35PREDICTED: cytokinin hydroxylase-like [Glycine max... [more]
gi|356534131|ref|XP_003535611.1|0.000000e+070.02PREDICTED: cytokinin hydroxylase-like [Glycine max... [more]
gi|356575971|ref|XP_003556109.1|0.000000e+068.35PREDICTED: cytokinin hydroxylase-like [Glycine max... [more]
gi|356534133|ref|XP_003535612.1|0.000000e+068.02PREDICTED: cytokinin hydroxylase-like [Glycine max... [more]
gi|356561544|ref|XP_003549041.1|0.000000e+068.74PREDICTED: LOW QUALITY PROTEIN: cytokinin hydroxyl... [more]
gi|356529204|ref|XP_003533186.1|0.000000e+067.64PREDICTED: cytokinin hydroxylase-like [Glycine max... [more]
gi|224134853|ref|XP_002321921.1|0.000000e+060.57hypothetical protein POPTR_0015s13020g [Populus tr... [more]
gi|596053274|ref|XP_007220755.1|0.000000e+060.47hypothetical protein PRUPE_ppa024029mg [Prunus per... [more]
gi|470147201|ref|XP_004309204.1|0.000000e+059.14PREDICTED: cytochrome P450 734A1-like [Fragaria ve... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001128Cytochrome P450PRINTSPR00385P450coord: 336..353
score: 2e-10coord: 388..399
score: 2e-10coord: 465..474
score: 2e-10coord: 474..485
score: 2
IPR001128Cytochrome P450GENE3D1.10.630.10no descriptioncoord: 44..525
score: 8e
IPR001128Cytochrome P450SUPERFAMILY48264Cytochrome P450coord: 45..525
score: 1.7
IPR002401Cytochrome P450, E-class, group IPRINTSPR00463EP450Icoord: 100..119
score: 1.2e-21coord: 325..342
score: 1.2e-21coord: 345..371
score: 1.2e-21coord: 464..474
score: 1.2e-21coord: 474..497
score: 1.2
IPR017972Cytochrome P450, conserved sitePROSITEPS00086CYTOCHROME_P450coord: 467..476
score
NoneNo IPR availableSEGsegsegcoord: 16..35
score: NAcoord: 68..79
score: NAcoord: 340..354
score: NAcoord: 488..499
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0025s0110.1 ID=Medtr0025s0110.1|Name=Medtr0025s0110.1|organism=Medicago truncatula|type=mRNA|length=1581bp
ATGGAGTTTGTAACTTTATCAGAAGTTCTTGATGTACTCACTTCAATAAT
ATTTGCTATATGTCTTTGCTTGCTCACAACACTAACAATTTTTTGGTGGA
TTTTACCTAATCAAAAATTTCAAAACCTTAGAAGATGTGGATTTGATGGG
CCAACCCCAAGTTTTCCACTTGGAAACATCAAAGAGATGAAAAGGAATAA
AAGCCTTAAATCTTCTTTTTCTTCTTCATGTGAGTCCATGGCCTTAGATA
TTACCCATGACATCCACTCTACCATTTCTCCTTATTATTCTTCTTGGCAA
AAATCTTACGGGAAAGTTTTCATATATTGGTTGGGGACAGAGCCATTTTT
ATACATTACAGACCCTGAATTCTTGAAGAAAATGTCCACAAAGGTTTTGG
CCAAGACATGGGGAAAACCTAGTGTGTTTAGAAAAGACAGGGATCCCATG
TTTGGAAATGGTTTGGTCATGGCTGAAGGCAACAAGTGGGTACATCATCG
ACATATTATAGCCCCAGCATTTTCTCCACTTAATCTTAAGAGAATGGCAA
TAATGATGGTTGATTCCACGAAGAAAATGATAGAAAGTTGGATTTCCCAA
ATAAACTCTGGCCACTTCGAAATCGATGTTGAAAGAGAGATCGTAACCAC
TGCTGGAGAGATCATAGCAAGAGCAAGCTTTGGAATGGGAGATGAAAATG
GAAAGAAAGTGTTTGATCAACTAAAAACTTTGCAAATGACCCTTTTTAAG
ACCAATAGATATGTGGGTGTCCCATTTGAGAAAATTTTCAATATCAAGAA
AACACTAGAGACCAGGAAACTTGGTGAAGAAATTAACAAGCTCATGTTTT
CCATCATAGAAGCTAGAATGAATTCAAATGATAAGATACAACATCAACAA
GATTTGTTAGGTCATTTGTTAAAAGAAAATAATGGGACTTATGGACAGTT
GAACAAGGCATTAACAAAGAAGGAATTGGTTGATGAGTGCAAGACATTTT
TCTTTGGTGGATATGAGACCACATCACTTTCAATCACATGGACTTTGCTG
CTTCTAGCTTTGCATGAAGATTGGCAAAACCAATTGAGAGATGAAATTAA
AGAAGTTGTTGGCAAGGAAGAACTTGATATCAATTTTCTTGCTGATTTAA
AGAAGATGAAATGGGTGAGGAGTGAAGCACTTAGACTCTACCCACCATCT
CCAAATGTGCAAAGGCAAGCTAAGGAGGATATTCGAGTAGATAATATAAA
GGTGCCTAAAGGGACCAACATTTGGATTGACGTTGTAGCAATGCACCATG
ACATGACATTATGGGGGAATGATGCAAACAAGTTTAAACCAGAGAGGTTC
ATGAATGATGCCAATGGGGAATGCCACCACACAATGGGGTACTTGCCTTT
TGGTTTTGGAGGGAGAGCATGTATTGGTAGGAACTTGATCTTCATGGAGT
ATAACATAGTGTTAACCCTACTTCTTACTAAGTTTAAGTTTAAACTCTCC
CCTAGTTATCATCATTCTCCTACTATCATGTTGTCTCTAAGACCCACTTA
TGGAATTCCTCTCATAGTTCAACCATTGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001128Cytochrome P450
IPR002401Cytochrome P450, E-class, group I
IPR017972Cytochrome P450, conserved site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004497monooxygenase activity
GO:0005506iron ion binding
GO:0009055electron carrier activity
GO:0020037heme binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0016491oxidoreductase activity
Vocabulary: Biological Process
TermDefinition
GO:0055114oxidation-reduction process
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part