Overview
NameMedtr0025s0060.1
Unique NameMedtr0025s0060.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length4008
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0006508 proteolysis
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005794 Golgi apparatus
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0012505 endomembrane system
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0003824 catalytic activity
molecular_function GO:0004175 endopeptidase activity
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0008233 peptidase activity
molecular_function GO:0070011 peptidase activity, acting on L-amino acid peptides
molecular_function GO:0017171 serine hydrolase activity
molecular_function GO:0004252 serine-type endopeptidase activity
molecular_function GO:0008236 serine-type peptidase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00082.1723613-2504974-5522-281196.75.6e-62197.32.5e-58
PF12580.325869-26453826-10201-194208.85.7e-66209.52.4e-62

Homology
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|356530860|ref|XP_003533997.1| (PREDICTED: tripeptidyl-peptidase 2-like isoform 1 [Glycine max])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|356559794|ref|XP_003548182.1| (PREDICTED: tripeptidyl-peptidase 2-like [Glycine max])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|356530862|ref|XP_003533998.1| (PREDICTED: tripeptidyl-peptidase 2-like isoform 2 [Glycine max])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|502119260|ref|XP_004496557.1| (PREDICTED: tripeptidyl-peptidase 2-like [Cicer arietinum])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|356535869|ref|XP_003536465.1| (PREDICTED: tripeptidyl-peptidase 2-like [Glycine max])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|590672782|ref|XP_007038708.1| (Tripeptidyl peptidase ii [Theobroma cacao] >gi|508775953|gb|EOY23209.1| Tripeptidyl peptidase ii [Theobroma cacao])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|302143856|emb|CBI22717.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|359490505|ref|XP_002268078.2| (PREDICTED: tripeptidyl-peptidase 2 [Vitis vinifera])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|470144889|ref|XP_004308079.1| (PREDICTED: LOW QUALITY PROTEIN: tripeptidyl-peptidase 2-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0025s0060.1 vs. NCBI nr
Match: gi|224119992|ref|XP_002318216.1| (hypothetical protein POPTR_0012s13100g [Populus trichocarpa] >gi|566198253|ref|XP_006377066.1| subtilase family protein [Populus trichocarpa] >gi|222858889|gb|EEE96436.1| hypothetical protein POPTR_0012s13100g [Populus trichocarpa] >gi|550327023|gb|ERP54863.1| subtilase family protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0025s0060.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356530860|ref|XP_003533997.1|0.000000e+085.11PREDICTED: tripeptidyl-peptidase 2-like isoform 1 ... [more]
gi|356559794|ref|XP_003548182.1|0.000000e+085.47PREDICTED: tripeptidyl-peptidase 2-like [Glycine m... [more]
gi|356530862|ref|XP_003533998.1|0.000000e+084.65PREDICTED: tripeptidyl-peptidase 2-like isoform 2 ... [more]
gi|502119260|ref|XP_004496557.1|0.000000e+077.99PREDICTED: tripeptidyl-peptidase 2-like [Cicer ari... [more]
gi|356535869|ref|XP_003536465.1|0.000000e+079.40PREDICTED: tripeptidyl-peptidase 2-like [Glycine m... [more]
gi|590672782|ref|XP_007038708.1|0.000000e+074.94Tripeptidyl peptidase ii [Theobroma cacao] >gi|508... [more]
gi|302143856|emb|CBI22717.3|0.000000e+074.60unnamed protein product [Vitis vinifera][more]
gi|359490505|ref|XP_002268078.2|0.000000e+074.31PREDICTED: tripeptidyl-peptidase 2 [Vitis vinifera... [more]
gi|470144889|ref|XP_004308079.1|0.000000e+072.88PREDICTED: LOW QUALITY PROTEIN: tripeptidyl-peptid... [more]
gi|224119992|ref|XP_002318216.1|0.000000e+073.63hypothetical protein POPTR_0012s13100g [Populus tr... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000209Peptidase S8/S53, subtilisin/kexin/sedolisinPRINTSPR00723SUBTILISINcoord: 69..88
score: 7.1e-11coord: 301..314
score: 7.1e-11coord: 488..504
score: 7.1
IPR000209Peptidase S8/S53, subtilisin/kexin/sedolisinGENE3D3.40.50.200no descriptioncoord: 304..552
score: 2.8
IPR000209Peptidase S8/S53, subtilisin/kexin/sedolisinSUPERFAMILY52743Subtilisin-likecoord: 49..562
score: 6.1
IPR022398Peptidase S8/S53, subtilisin, active sitePROSITEPS00138SUBTILASE_SERcoord: 489..499
score
NoneNo IPR availableCOILcoilcoiled-coilcoord: 199..227
score
NoneNo IPR availableSEGsegsegcoord: 4..34
score: NAcoord: 206..219
score: NAcoord: 286..299
score: NAcoord: 683..692
score: NAcoord: 1065..1078
score: NAcoord: 1297..1308
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0025s0060.1 ID=Medtr0025s0060.1|Name=Medtr0025s0060.1|organism=Medicago truncatula|type=mRNA|length=4008bp
ATGCCTTGCGATTCTTCCGTCATTTCTAGCGATAACAGTAACAGCAACAA
CAACAACGAGAAAGAGAAGAGTAAGAAAAGCGATGATTCTTCTTCTTCTT
CACTCGGTGATTTCAAATTGAACGAATCTACGTTTTTAGCTTCACTCATG
CCGAAGAAAGAAATCGGAGTTGATCGATTTCTTCATTCTAACCCTAATTA
CGATGGTCGCGGTGCTTTAATCGCCATTTTCGATTCTGGTGTAGATCCGG
CCGTTGATGGATTACAGGTTACCACAGATGGGAAACCAAAAATTCTTGAT
GTCATTGATTGTACTGGGAGTGGTGATATTGATACCTCGAAGGTCGTGAA
GGCTGATGCAGATGGTTGTATTTCTGGGGCATCAGGGGCATCTTTGGTTA
TTAATACTTCATGGAAAAATCCTTCTGGTGAATGGCATGTGGGTTATAAA
TTGGTTTATGAGCTCTTTACAGAAGATTTGACCTTTCGTTTGAAGAAAGA
AAGAAGGAAAAAGTGGGATGAGAAAAACCAGGAGGAAATTGCGAGGGCAG
TAAAACAGCTTGATGACTTTGATCAGAAACACATAAAGGTTGAGGATGGA
AAGCTTAAGAGGGTTCGTGAAGATCTGCAAAATAGGCTTGATCTTCTGAG
GAGGCAATCTGAGAGCTATGATGATAATGGACCCGTTGTAGATGCTGTTG
TCTGGCATGATGGGGATGTCTGGAGGGCTGCCCTTGACACACAGAGTCTT
GAAGATGATCCGGATTGTGGAATGCTTGCTAACTGTGTGCCTTTAACTAA
TTATAGGATTGAGAGGAAATACGGCGTCTTCAGCAAATTAGATGCTTGTA
CATTTGTTGTTAATGTCTTTAATAATGGGAATGTTTTAAGTGTTGTAACA
GACTGTTCTCCCCATGCCACCCATGTTGCTGGTATAGCTGCTGCTTTCCA
CCCGAAGGAGCCTTTGTTGAATGGAGTTGCACCTGGGGCACAATTAATAT
CTTGTAAAATTGGGGATTCCCGCTTAGGTTCTATGGAAACCGGAACTGGT
TTGATTCGGGCACTGATAGCTGCTGTCGAGCATAAATGCGATCTTATCAA
TATGAGTTATGGTGAAGCAACTTTACTGCCTGACTATGGACGCTTTGTTG
ACCTTGTGAATGAGGTGGTGAACAAGCATCGTCTGATATTTGTGAGCAGT
GCTGGTAATAGTGGTCCAGGATTGAGCACTGTTGGTGCACCTGGTGGTAC
ATCTTCGAGTATCATCGGTGTTGGTGCATATGTTTCTCCTGCTATGGCTG
CTGGTGCTCATTGTGTTGTTGAACCTCCATCAGAGGGGCTTGAGTACACT
TGGTCTAGCCGAGGGCCAACAGCTGATGGAGACCTTGGTGTCTGTATAAG
TGCTCCTGGTGGTGCTGTTGCTCCTGTTCCTAAGTGGACTCTTCAACGGC
GCAGGCTCATGAACGGGACATCAATGGCATCACCATCAGCCTGTGGTGGA
ACTGCATTGCTCATAAGTGCAATGAAGGCTGAGGGAATTCCTGTGAGTCC
ATATAGTGTGAGGAAGGCTCTTGAGAATACTGCAGATCCCATAGGTGATT
TACCTGAAGATAAATTGTCCACTGGACAAGGGCTGATGCAAGTCGACAAG
GCTTTTGAATATATACAGAAGTGTCAAAACTTTCCATGTGTTCAGTATCA
GATAAATATCCAGCAATCTGGAAAAACACGTCCTTCATCACGAGGTATCT
ACCTGAGGGAGCCTAGTGCTTGTCGGCAAACTACTGAGTGGGTAGTGGAA
GTTAATCCAAAGTTTCATGAAGATGCCAGCAATTTTGAGGAAAAGATTCC
TTTTGAGGAATGCATTGAGTTATATTCTACTGAGAAGACAGTTGTGAAAA
CCCCTGATTATCTATTGCTCACTCATAATGGCCGCAGCTTCAATCTAGTT
GTGGATCCTTCCAATCTATGTGATGGTCTTCACTACTATGAAGTCTATGG
TATCGACTGCAAAGCGCCATGGCGAGGGCCTATTTTCAGAATTCCTATTA
CCATAACAAAGGCCAAGGCTACAACTAACCAGCCCCTACAAGTTTCATTT
TCAAATATGTTGTTCCAGCCAGGTCATATTGAAAGGAGATATATAGAAGT
GCCACACGGTGCATCTTGGGCTGATGTAACAATTAAATCATCAGGGTTTG
ACACACCTCGGAAATTTTATATTGATGCTGTTCAGATGTGCCCATTGCAA
AGACCTCTGAAATGGGAAAAGGCGGTGACTTTTGCTTCTTCGGGTGCCAA
AAGCTTTGCCTTTAGGGTAATAAGTGGTCAGACATTGGAAATAGTCATTT
CTCAGTTTTGGTCAAGTGGCATAGGGAGTCATGAGTCTGCCAGTGTGAAT
TTTGAGGTTGTTTTTCATGGGATAAAAGTGAATCAAGAAGAACTTTTACT
TGATGGAAGTGAAGCACCAGTCAGAATTGATGCTGAAACGCTGCTGGTTT
CAGAAGAGCTTGCTCCAGTGGCTATTTTAAACAAGATTAGGGTTCCTTAT
CGACCAATAGATTCTAAGATTTGTGCACTCTCAGCAGATCGCGATAAACT
TCCATCTGGAAAACAGATACTGGCGCTGACTTTGACCTACAAGGTCAAAT
TGGAAGATGGAGCTCAAGTAAAACCTCATATACCATTGCTAAATGACCGG
ATATATGACACTAAATTCGAGTCTCAATTTTACATGATTTCTGACTCAAA
TAAGCGCGTATACTCACGTGGAGATGCGTATCCAAGCTCTTCAAATCTTC
CCAAGGGAGAATATAATTTGCAGCTCTATTTGAGGCATGACAATGTGCAA
ATTTTGGAAAAGATGAGGCATTTGGTGTTATTCCTTGAGAGAAACTTGGA
GGAGAAGGATGTTATTCGGTTAAATTTTTTCTCTCAACCTGATGGCCCAC
TGATGGGAAATGGTTCCTTTAAGTCCTCAATATTGATTCCAGGTATGAAA
GAAGGATTATATATTGGTCCACCACAAAAAGAAAAGCTGCCCAAGAATTC
TCAGCAAGGATCTGTATTGATTGGGGCAATTTCATATGGGAAACTATCAT
TTTCTGATCAGCAGGAGAAAAATAATCCAGAAAAGCACCCTGCTTCATGT
CGAATTTCTTATGTAGTTCCTCCAAATAAGGTTGATGAGGACAAGGGAAA
AGGTTCTTCCATATCTACCAAAAAGACCGTTTCTGAACGTATAAAAGAAG
AGGTAAGAGATGCAAAAATAAAAGTTCTGGGAACCCTAAAACAGGAAAAT
GATGAAGATCGCTTGGAGTGGAAAGAGCTTGCTGCCTCGCTCAAATTAGA
ATATCCAAAATACACTTCATTGCTTGCGAAGATTTTGGAAGGTTTAGTTT
CTAGGAGTAATATCAAAGATAAAATCCATCATGATGAAGAGGTGATTGGT
GCAGCAAATGATGTGATTGACAGTGTTGACAGGGAAGAGTTAGCAAAATT
TTTTGCACTAAAAAATGATCCAGAAGACGACGATGCAGAGAATACCAGGA
AAAAGTTTGAGTCTATCCGAGACCAGTTAGCAGAGGCACTTTACCAAAAG
GGGCTCGCGCTGGCAGAGATTGAATCCTTAAAGTTGGCAGACTTGACTTG
GTGTATATTGTCAAAGGATTTGGATGCAAAAGAAGATGTGGACAGTGAGA
AATCTACAGATGGTGGTGGCAGTCATCCAGATTTGTTCGAAGAGAATTTT
CTAGAGCTGAAGAAATGGGTTGATGTAAAGTCATCTAAATATGGAATCCT
CACGGTAACACGTGAGAGGCGTTCTAAAAGGCTTGGGACTGCATTGAAGG
TACTCTCTGACATAATTCAAAATGATGTTGAGCCTGCCAAGAAGAAACTA
TATGAGCTAAAGCTCTCATTACTTGATGAGATTGGATGGAAATATTTAGC
TACATACGAAAGACAGTGGATGCTTGTGCGTTTCCCTCCAACCTTGCCCC
TTTTCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000209Peptidase S8/S53, subtilisin/kexin/sedolisin
IPR022398Peptidase S8/S53, subtilisin, active site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004252serine-type endopeptidase activity
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004175endopeptidase activity
GO:0008236serine-type peptidase activity
GO:0008233peptidase activity
GO:0070011peptidase activity, acting on L-amino acid peptides
GO:0016787hydrolase activity
GO:0017171serine hydrolase activity
Vocabulary: Biological Process
TermDefinition
GO:0006508proteolysis
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0005794Golgi apparatus
GO:0012505endomembrane system
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part