Overview
NameMedtr0025s0050.1
Unique NameMedtr0025s0050.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length600
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF05970.917145-1700261-108290-33732.03.9e-1247.79.3e-13

Homology
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502156462|ref|XP_004510486.1| (PREDICTED: uncharacterized protein LOC101514966, partial [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502131846|ref|XP_004501122.1| (PREDICTED: uncharacterized protein LOC101510714, partial [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502114320|ref|XP_004494929.1| (PREDICTED: uncharacterized protein LOC101492850, partial [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502090176|ref|XP_004489145.1| (PREDICTED: uncharacterized protein LOC101512586 [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502129922|ref|XP_004500470.1| (PREDICTED: uncharacterized protein LOC101490822, partial [Cicer arietinum] >gi|502142384|ref|XP_004504931.1| PREDICTED: uncharacterized protein LOC101515354, partial [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502155583|ref|XP_004510124.1| (PREDICTED: uncharacterized protein LOC101506803 [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502134642|ref|XP_004502192.1| (PREDICTED: uncharacterized protein LOC101501924 [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|502178533|ref|XP_004516277.1| (PREDICTED: uncharacterized protein LOC101496422 [Cicer arietinum])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|565449975|ref|XP_006285587.1| (hypothetical protein CARUB_v10007032mg [Capsella rubella] >gi|482554292|gb|EOA18485.1| hypothetical protein CARUB_v10007032mg [Capsella rubella])
BLAST of Medtr0025s0050.1 vs. NCBI nr
Match: gi|565478310|ref|XP_006296795.1| (hypothetical protein CARUB_v10016214mg [Capsella rubella] >gi|482565504|gb|EOA29693.1| hypothetical protein CARUB_v10016214mg [Capsella rubella])
The following BLAST results are available for this feature:
BLAST of Medtr0025s0050.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502156462|ref|XP_004510486.1|2.383600e-4855.63PREDICTED: uncharacterized protein LOC101514966, p... [more]
gi|502131846|ref|XP_004501122.1|2.606110e-4855.63PREDICTED: uncharacterized protein LOC101510714, p... [more]
gi|502114320|ref|XP_004494929.1|2.795820e-4855.63PREDICTED: uncharacterized protein LOC101492850, p... [more]
gi|502090176|ref|XP_004489145.1|3.506630e-4755.00PREDICTED: uncharacterized protein LOC101512586 [C... [more]
gi|502129922|ref|XP_004500470.1|3.607280e-4755.00PREDICTED: uncharacterized protein LOC101490822, p... [more]
gi|502155583|ref|XP_004510124.1|4.283680e-4755.00PREDICTED: uncharacterized protein LOC101506803 [C... [more]
gi|502134642|ref|XP_004502192.1|4.774870e-4755.00PREDICTED: uncharacterized protein LOC101501924 [C... [more]
gi|502178533|ref|XP_004516277.1|4.790570e-4755.00PREDICTED: uncharacterized protein LOC101496422 [C... [more]
gi|565449975|ref|XP_006285587.1|4.099460e-4351.52hypothetical protein CARUB_v10007032mg [Capsella r... [more]
gi|565478310|ref|XP_006296795.1|2.189780e-3948.03hypothetical protein CARUB_v10016214mg [Capsella r... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 25..36
score
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 134..197
score: 1.4

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0025s0050.1 ID=Medtr0025s0050.1|Name=Medtr0025s0050.1|organism=Medicago truncatula|type=mRNA|length=600bp
ATGCCAACCTTCACGAATAAGCTTATTGTTGATGAGCTAAGTTATGACAA
GGTTGAATTGGCAAAGACACATGAGGATCTATTATTGAGGTTGAATAACG
AACTTAGATGTGTATATGATAAGATCACGAAGTCTGTTCTTTTTGGTAGT
AGTGGTTTATTTTTCATATATGGTTATGGTGGTGAAGAGAAAGAGTTTTT
AAGCTATGATTCTGTTTTTCAATCGAGCGAAAATTCTGATGTCCAAAGCG
AGTGGTTCACAACAGAATTTCTTAATGGTATTAAGAGCTCTGGAATTCCA
AATGACCGGTTGAAACTAAGGCTGAAAGTTACACATCTAGGAAAGAGCAC
GATAGTTGCTACCGTAATTACAGGAAAAAGGGCAAGTACCAAGGTATTCA
TTCCCAGGATGAATCTTATTCCGAGTGATTCAAGACTACCCTTCAAATTC
AGGCGCAGGCAATTTCCATTGACGCTTTGTTTTGCAATGACAATGAATAA
AAGTCAGGGTCAATATTTATCTCGAGTGGGAGTTTATCTTCCTAAGCCCG
TGTTCATGCATGGACAACTCTATGTCGTTGTCTCTCGAGTTATTTCATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated