Overview
NameMedtr0025s0030.1
Unique NameMedtr0025s0030.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length321
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01107.1310182-1039421-912-6729.82.2e-1130.12.6e-07

Homology
BLAST of Medtr0025s0030.1 vs. NCBI nr
Match: gi|9629141|ref|NP_044299.1| (putative transport protein [Soybean chlorotic mottle virus] >gi|139996|sp|P15631.1|MOVP_SOCMV RecName: Full=Movement protein; Short=Mov; AltName: Full=Cell-to-cell transport protein; AltName: Full=ORF IA >gi|58842|emb|CAA33833.1| putative transport protein [Soybean chlorotic mottle virus])
The following BLAST results are available for this feature:
BLAST of Medtr0025s0030.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|9629141|ref|NP_044299.1|2.740480e-1447.19putative transport protein [Soybean chlorotic mott... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 33..51
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0025s0030.1 ID=Medtr0025s0030.1|Name=Medtr0025s0030.1|organism=Medicago truncatula|type=mRNA|length=321bp
ATGACTGAGGTTTCATACTTTGAAGGAACATCTAGTTATTATGCTGATGA
CATAATAGATAATAAGATAGAAGAAGCAGATTTATCTTTAACTGCTGAAG
AAAATTTCAAAAGAAAGTTTAATAAATTCAAAGAATTTTTCTCAAGAAAA
AATATTTTGAAATTTGGAATAATCATAAGAGAAGAAGCAATTTCAATTGA
AAATACTCAAGGAAATATAGTCATATCTACCATACATAAAACTCAAATTG
AAAAAAGAATTGAAACATTTTCTGAAAAAGAAAAATTGGTTATATTCATA
TATCAACTATTCAAATCTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated