Overview
NameMedtr0024s0330.1
Unique NameMedtr0024s0330.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2208
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0008283 cell proliferation
biological_process GO:0009987 cellular process
biological_process GO:0050789 regulation of biological process
biological_process GO:0042127 regulation of cell proliferation
biological_process GO:0050794 regulation of cellular process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF10497.4150914-15121637-1371-104130.31.8e-42130.32.5e-38

Homology
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|502181267|ref|XP_004516770.1| (PREDICTED: uncharacterized protein LOC101497520 [Cicer arietinum])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|225451978|ref|XP_002279849.1| (PREDICTED: uncharacterized protein LOC100265236 [Vitis vinifera])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|356573674|ref|XP_003554982.1| (PREDICTED: uncharacterized protein LOC100780800 [Glycine max])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|356551084|ref|XP_003543908.1| (PREDICTED: uncharacterized protein LOC100820577 isoform X1 [Glycine max])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|590653030|ref|XP_007033309.1| (Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 3 [Theobroma cacao] >gi|508712338|gb|EOY04235.1| Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 3 [Theobroma cacao])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|590653022|ref|XP_007033307.1| (Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 1 [Theobroma cacao] >gi|508712336|gb|EOY04233.1| Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|590653026|ref|XP_007033308.1| (Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 2 [Theobroma cacao] >gi|508712337|gb|EOY04234.1| Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 2 [Theobroma cacao])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|502181308|ref|XP_004516775.1| (PREDICTED: uncharacterized protein LOC101499057 [Cicer arietinum])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|590653034|ref|XP_007033310.1| (Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 4, partial [Theobroma cacao] >gi|508712339|gb|EOY04236.1| Zinc-finger domain of monoamine-oxidase A repressor R1 protein, putative isoform 4, partial [Theobroma cacao])
BLAST of Medtr0024s0330.1 vs. NCBI nr
Match: gi|298204383|emb|CBI16863.3| (unnamed protein product [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0330.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502181267|ref|XP_004516770.1|2.647860e-17965.53PREDICTED: uncharacterized protein LOC101497520 [C... [more]
gi|225451978|ref|XP_002279849.1|2.068460e-13938.37PREDICTED: uncharacterized protein LOC100265236 [V... [more]
gi|356573674|ref|XP_003554982.1|5.609130e-13949.33PREDICTED: uncharacterized protein LOC100780800 [G... [more]
gi|356551084|ref|XP_003543908.1|5.885010e-13662.07PREDICTED: uncharacterized protein LOC100820577 is... [more]
gi|590653030|ref|XP_007033309.1|4.408980e-13538.54Zinc-finger domain of monoamine-oxidase A represso... [more]
gi|590653022|ref|XP_007033307.1|3.197550e-13438.78Zinc-finger domain of monoamine-oxidase A represso... [more]
gi|590653026|ref|XP_007033308.1|1.254380e-12238.01Zinc-finger domain of monoamine-oxidase A represso... [more]
gi|502181308|ref|XP_004516775.1|2.457870e-12061.76PREDICTED: uncharacterized protein LOC101499057 [C... [more]
gi|590653034|ref|XP_007033310.1|4.152380e-12037.69Zinc-finger domain of monoamine-oxidase A represso... [more]
gi|298204383|emb|CBI16863.3|4.986280e-8342.47unnamed protein product [Vitis vinifera][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR018500DDT domain, subgroupSMARTSM00571no descriptioncoord: 436..501
score: 0.0
IPR018501DDT domain superfamilyPROFILEPS50827DDTcoord: 436..501
score: 10
NoneNo IPR availableCOILcoilcoiled-coilcoord: 578..613
score
NoneNo IPR availableSEGsegsegcoord: 197..208
score: NAcoord: 234..252
score: NAcoord: 272..294
score: NAcoord: 582..599
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0330.1 ID=Medtr0024s0330.1|Name=Medtr0024s0330.1|organism=Medicago truncatula|type=mRNA|length=2208bp
ATGGAAATCGATTCAGCTTCACCAGAACTGAACGTGAAAGGGAGTGATGC
GAATGGAAAGAAATTGAATCGGAACAATAAATGCGGAGTTCGTGTTATTG
GAAATCGAATCTATGATTCTGCTAATGGCAAAACTTGTCATCAGTGCCGG
CAAAAAACAAGGGACTTTTCTGCTGCTTGTAAGAATCCAAGAACTGGGAA
GCCTTGCCAAATTAGGTTCTGCCACAAGTGCCTCTTGAACAGATATGGTG
AAAAGGCAGAAGAGGTAGAACTATTGAATGATTGGATGTGCCCAAAGTGC
AGAGGCATTTGCAACTGCAGTTTTTGCATGAAAAAAAGAGGTGAACAACC
AACTGGTATACTAGTTCATTCGGCCAAGGCATCGGGTTTTAACTCTGTGT
CAGCAATGCTTAGAAAGAAGGCTTCTGAAAGTTTGGAAACGAACAATGCT
GTGGTTTTGCCTATAAAGGAAACTACACTGGAAAAGGAGCTAGTGGTAGA
TCTATTTGGGGAACCCGAGAAGCTGAATTCACTAGGTGGAAACAAAGGTT
TAAAGGTTGAAAATGAGAAAACCAAGAAAGTGAATCGGAAAAAGTTAAAG
GAACCTACTTTGGAAAAGGAGCTTGTAGTGGATCTATCTGGGGAACCTGT
GAAGCAGAATTCAGTAGGTGGAAACATAGGTTTAAAGGTTGAAAATGGGA
AAACCAAGACAATGAAGCGGAAAAAGTTAAAGGAAGATACTCTGGAAAAG
GAGCTAGTAGTGGATCTATCAGGGGAACCTGGGAAGCAGAATTCAGTAGG
TGAAAACATAGGTTTAAAGGTTGAAAATGAGAAAACCAAGACAGTGAAGA
AGAAAAAGTTAAAGGAAACTACTCTGGGAAAGGACCGGAAGGAGTATATA
CTACAGGAGGTTGTCTTGGGTCTATCATGTGAACCTGGGAAAGAAAACTC
CTCAGGTGGAGTTAATGCTTCAAAGGTTGGACGTGAGAAAACCAAGAAAG
TGAAGCGGGAAAACTTAAAGGAAATATCCAATGGCAACAGTGTTGATGAT
GCTTGCCAAAACAAGAAATCGAAAAAGCCTAAACTTTCTAATGTAGTTTC
AGAGGGTGGAGTGAAACCAAAAGCAGATTCTGAAATGGGAACAAAAATAG
GGGAGAATCATGGCACTGTTGTGATAGGAGATGGTGACAATGCTGGTGCC
AAGTCCCAAACAAATGCTAAAGTTTTGCATGAAGAAAAAATTAAGGAAGA
AATTTCTTTCCCCCTTGGCACTGAGATGACTAAAATATTAGACATTGAGT
TTGCACCAGAAGATGTTGGGAATGCATTGCAGTTTTTAGAATTCTGCAAA
GTGTTTGGAAAGGCTCTTGATGTCAAGAAAGGAGAAGCGGTAGCTGTTCT
AAGAGCATTGATACGTAAGCAAAATTTGCGACGTGGACAAAACACCTTAG
TGGTTGAGTTCCAAATCAAACTGTTGACTTTGATAGTATCTGATTCAGAA
ACCGAGTCTTCATCCTTAACTGCTAGCAATGGAAAAAACTCATGGTTGAA
AGTTCTGGAGGATTTGATTACCGAATCTGATGCTGCGCTAAAAGAATTTC
CTGCGGATTGGCTTAATAAAGGCATAAGCGGATATTATGATTTGGACTTA
TCCAAAAAGCTTATCCTTCTGAATTTTATTTGTGATGAAGCTTTGAGCAC
GATGAAGCTAAGGAATTTTATAGATGATCAAAATGCAAGATTTGCTGAAG
AAAAGAAAGCAGCAAAGTCTAAGGTTTCTGATGCTAAGGAAAAGGAAAGA
AGTCTTAAGCAAAAGTTGCAGGATGAGATTGCAAATGCTGTTGTATCAAG
TGGAGCTAGCCTCTCAATTTCAGAACATGATGCTCTTCTTGCAAAGATAA
AAAGTGAAGCAACTAAAGCTCATACTGAGTTGATTGAGGCAAAAGGCACA
ATTCCTAAACGGAACCGGCATTGTGATACAGTGAGAATTGAGCCTGAATA
CTTGGATAGCAATGGTAAGACATTCTGGAAATTAAGAAGCTGTAATGATG
AATATGCCTTTATGTTACAAGATTTGAAGATCCATGATGAAGATGGTGTT
GAAGTTGATGAAAAATGGTTTGTTTATGGAGCTGAACAGAAGGACGAGGT
TAATAAGTACATTTCCTCTAGGAGACATTGGTTACCAAAGCTGACTTCAA
CCTTCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR018500DDT domain, subgroup
IPR018501DDT domain superfamily
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008150biological_process
GO:0008283cell proliferation
GO:0009987cellular process
GO:0042127regulation of cell proliferation
GO:0044699single-organism process
GO:0050789regulation of biological process
GO:0050794regulation of cellular process
GO:0065007biological regulation