Overview
NameMedtr0024s0320.1
Unique NameMedtr0024s0320.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length492
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0008152 metabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0009698 phenylpropanoid metabolic process
biological_process GO:0019748 secondary metabolic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0004180 carboxypeptidase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0008047 enzyme activator activity
molecular_function GO:0030234 enzyme regulator activity
molecular_function GO:0008238 exopeptidase activity
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0008233 peptidase activity
molecular_function GO:0070011 peptidase activity, acting on L-amino acid peptides
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00450.17145093-14498638-73172-20720.41.5e-0851.86.1e-14

Homology
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|502155835|ref|XP_004510209.1| (PREDICTED: serine carboxypeptidase-like 20-like [Cicer arietinum])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|225815|prf||1314177B (CPase I B)
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|475575848|gb|EMT17380.1| (Serine carboxypeptidase-like protein 3 [Aegilops tauschii])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|255572660|ref|XP_002527263.1| (serine carboxypeptidase, putative [Ricinus communis] >gi|223533356|gb|EEF35107.1| serine carboxypeptidase, putative [Ricinus communis])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|388511028|gb|AFK43580.1| (unknown [Lotus japonicus])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|255547558|ref|XP_002514836.1| (serine carboxypeptidase, putative [Ricinus communis] >gi|223545887|gb|EEF47390.1| serine carboxypeptidase, putative [Ricinus communis])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|356558940|ref|XP_003547760.1| (PREDICTED: serine carboxypeptidase-like 20-like isoform 2 [Glycine max])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|356558938|ref|XP_003547759.1| (PREDICTED: serine carboxypeptidase-like 20-like isoformX1 [Glycine max] >gi|571526715|ref|XP_006599137.1| PREDICTED: serine carboxypeptidase-like 20-like isoform X2 [Glycine max] >gi|571526719|ref|XP_006599138.1| PREDICTED: serine carboxypeptidase-like 20-like isoform X3 [Glycine max] >gi|571526724|ref|XP_006599139.1| PREDICTED: serine carboxypeptidase-like 20-like isoform X4 [Glycine max])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|167012|gb|AAA32940.1| (carboxypeptidase I precursor, partial [Hordeum vulgare])
BLAST of Medtr0024s0320.1 vs. NCBI nr
Match: gi|388502824|gb|AFK39478.1| (unknown [Lotus japonicus])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0320.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502155835|ref|XP_004510209.1|1.788460e-1485.71PREDICTED: serine carboxypeptidase-like 20-like [C... [more]
gi|225815|prf||1314177B5.064530e-1375.00CPase I B[more]
gi|475575848|gb|EMT17380.1|1.163970e-1236.54Serine carboxypeptidase-like protein 3 [Aegilops t... [more]
gi|255572660|ref|XP_002527263.1|2.387050e-1276.19serine carboxypeptidase, putative [Ricinus communi... [more]
gi|388511028|gb|AFK43580.1|4.013170e-1271.43unknown [Lotus japonicus][more]
gi|255547558|ref|XP_002514836.1|5.017500e-1276.19serine carboxypeptidase, putative [Ricinus communi... [more]
gi|356558940|ref|XP_003547760.1|7.255960e-1273.81PREDICTED: serine carboxypeptidase-like 20-like is... [more]
gi|356558938|ref|XP_003547759.1|7.303580e-1273.81PREDICTED: serine carboxypeptidase-like 20-like is... [more]
gi|167012|gb|AAA32940.1|7.763690e-1275.00carboxypeptidase I precursor, partial [Hordeum vul... [more]
gi|388502824|gb|AFK39478.1|1.088980e-1171.43unknown [Lotus japonicus][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.40.50.1820no descriptioncoord: 38..73
score: 0.0001coord: 74..116
score: 2.6
NoneNo IPR availableSUPERFAMILY53474alpha/beta-Hydrolasescoord: 75..139
score: 8.1e-08coord: 39..73
score: 0.

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0320.1 ID=Medtr0024s0320.1|Name=Medtr0024s0320.1|organism=Medicago truncatula|type=mRNA|length=492bp
ATGGCCTCCATTCATCAACAATATTGTATCCAATTGATCTTGTCCGTGCT
TGACACCCCATTTGTTAACACTTTATCTCTAATAAAGTCTGTCAAGGCTT
CTCATGTGACACATGGTTACATAATTGGAAACGGTGTTACAGATGAACAA
ATTGATGACAATGCTCTTATTTCATTTGTACACGGGATGGGTCTTATCCC
AGATGAATTGTTCGAGGAGAGGCCATGGTTATCCAATGGTCAAGATGTTG
GATATACTAAAGGATATGACCACAATCTTAATTTTCTGACCATAAAGGGA
GCTAGACATACTGTTCCGGAATACAAACCACAAGAGGCTAAAATGATGGA
TTTAGAGCGTATTCGGCATGCTACTACATTTCTTCAATGGGATAAAGGCA
ACTACTATATTTTTCAAATCAAACCATCTTTGCATTTCATTCAATGGGAT
CCAGAAGGGTCGTCTCTTGTTCATCGAAGGAGTCGACAATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006725cellular aromatic compound metabolic process
GO:0008150biological_process
GO:0009698phenylpropanoid metabolic process
GO:0009987cellular process
GO:0019748secondary metabolic process
GO:0044237cellular metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044763single-organism cellular process
GO:0071704organic substance metabolic process
GO:1901360organic cyclic compound metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004180carboxypeptidase activity
GO:0008233peptidase activity
GO:0008047enzyme activator activity
GO:0008238exopeptidase activity
GO:0070011peptidase activity, acting on L-amino acid peptides
GO:0016787hydrolase activity
GO:0030234enzyme regulator activity