Overview
NameMedtr0024s0260.2
Unique NameMedtr0024s0260.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1071
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0005794 Golgi apparatus
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0012505 endomembrane system
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01694.17114844-115191217-3325-12092.91.2e-3092.91.6e-26

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0260.2 ID=Medtr0024s0260.2|Name=Medtr0024s0260.2|organism=Medicago truncatula|type=mRNA|length=1071bp
ATGGCTGCATTTTCAGTATGTTACAGAACACCTTACAAGAACACATGCAT
AGTTTTTGGCAAAGATTCTATATACAAGACCGCGACAAAATTACGTGTTC
AGTGTTCATCAGAGTCTACCTCTACTGAGTCTGAGAAGAAACTAAGATCG
TTAGATTCTTATTTTGGAAAACTACAACATAAAACAAAATTACATGTTTC
TGATGCATCAAGTGAGGTGATGAAGGTGCACCAAGAAAATGGTCAATCTG
AATCAAATCATGAACTTGAGTCTCTTGATGAGTATCTTGGCAAGCTAAAT
AATGGCATAAACCAAGAATCTCTTGTGGCATCTTATGTTGAAAATTCCAA
GGATGAAAGTTTAGCTCCGAAACAAATTCTCAGCCAAGATACTCAAAGAA
CAAATTTTAGGAAACCAAATACTTATGTCAATATAAGAAGAATACAAGGT
GTTAGTGGTTCAATATCTGCTATAGATTCACATGATCAGCTAAATGATAC
ATCCAGTCTTTACCTCATAGGTATATTGGCATCAGTGAACATTGGAGTGT
TTCTATTTGAAATTGCAAGTCCTATAAGGAATAATAACTTAGAGCTGTTT
TCACTTCCAATGCTATATGGAGCAAAGATAAACCATTTGATCATGGTTGG
AGAATGGTGGAGGCTTATAACACCAATGTTTCTGCATGCAGGGATATTTC
ACATGGCTCTGAGTTGTTGGGCCCTTGTATCATTTGGGCCTCAAGTTTGC
AAAGGCTATGGTTCATTTACATTTTTCTTGATCTACATACTTGGTGGAGT
TTCTGGCAACTTGGCAAGTTTTCTACATACACCAGATCCAACTGTCGGTG
GCACCGGACCTGCATTTGCAATAATTGGTGCTTGGCTCATGTACCAAATT
CAAAATAGAGATGTTATTGAAAATGATGATTCTGATAATCTATTCAAGAA
GGCAATAATTATTACAGCTCTTGGTTTCATCTTATGCAACCTTGGTCCAA
TTGATGAGTGGTATGTATGGCTTACATTATTTACAGAAAGTATTTTGATT
GATATAACACAAAAAAAATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0005794Golgi apparatus
GO:0012505endomembrane system
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part