Overview
NameMedtr0024s0260.1
Unique NameMedtr0024s0260.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1266
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0030447 filamentous growth
biological_process GO:0044182 filamentous growth of a population of unicellular organisms
biological_process GO:0040007 growth
biological_process GO:0048519 negative regulation of biological process
biological_process GO:0060258 negative regulation of filamentous growth
biological_process GO:1900429 negative regulation of filamentous growth of a population of unicellular organisms
biological_process GO:0045926 negative regulation of growth
biological_process GO:0050789 regulation of biological process
biological_process GO:0010570 regulation of filamentous growth
biological_process GO:1900428 regulation of filamentous growth of a population of unicellular organisms
biological_process GO:0040008 regulation of growth
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0009507 chloroplast
cellular_component GO:0009941 chloroplast envelope
cellular_component GO:0031969 chloroplast membrane
cellular_component GO:0044434 chloroplast part
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0031975 envelope
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044446 intracellular organelle part
cellular_component GO:0044424 intracellular part
cellular_component GO:0016020 membrane
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0031967 organelle envelope
cellular_component GO:0031090 organelle membrane
cellular_component GO:0044422 organelle part
cellular_component GO:0009536 plastid
cellular_component GO:0009526 plastid envelope
cellular_component GO:0042170 plastid membrane
cellular_component GO:0044435 plastid part
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01694.17114844-115260217-3555-143105.31.7e-34105.32.4e-30

Homology
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|502180641|ref|XP_004516684.1| (PREDICTED: uncharacterized protein LOC101511229 [Cicer arietinum])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|356545710|ref|XP_003541279.1| (PREDICTED: uncharacterized protein LOC100808799 isoform X1 [Glycine max] >gi|571496881|ref|XP_006593727.1| PREDICTED: uncharacterized protein LOC100808799 isoform X2 [Glycine max] >gi|571496883|ref|XP_006593728.1| PREDICTED: uncharacterized protein LOC100808799 isoform X3 [Glycine max])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|356573948|ref|XP_003555116.1| (PREDICTED: uncharacterized protein LOC100815930 [Glycine max])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|595937273|ref|XP_007215572.1| (hypothetical protein PRUPE_ppa007489mg [Prunus persica] >gi|462411722|gb|EMJ16771.1| hypothetical protein PRUPE_ppa007489mg [Prunus persica])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|224127432|ref|XP_002329276.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|225451989|ref|XP_002279924.1| (PREDICTED: uncharacterized protein LOC100256693 [Vitis vinifera])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|296087301|emb|CBI33675.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|255551392|ref|XP_002516742.1| (conserved hypothetical protein [Ricinus communis] >gi|223544115|gb|EEF45640.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|590653014|ref|XP_007033305.1| (Rhomboid-related intramembrane serine protease family protein, putative isoform 1 [Theobroma cacao] >gi|590653018|ref|XP_007033306.1| Rhomboid-related intramembrane serine protease family protein, putative isoform 1 [Theobroma cacao] >gi|508712334|gb|EOY04231.1| Rhomboid-related intramembrane serine protease family protein, putative isoform 1 [Theobroma cacao] >gi|508712335|gb|EOY04232.1| Rhomboid-related intramembrane serine protease family protein, putative isoform 1 [Theobroma cacao])
BLAST of Medtr0024s0260.1 vs. NCBI nr
Match: gi|470136741|ref|XP_004304142.1| (PREDICTED: uncharacterized protein LOC101293506 [Fragaria vesca subsp. vesca])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0260.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180641|ref|XP_004516684.1|0.000000e+076.78PREDICTED: uncharacterized protein LOC101511229 [C... [more]
gi|356545710|ref|XP_003541279.1|0.000000e+068.32PREDICTED: uncharacterized protein LOC100808799 is... [more]
gi|356573948|ref|XP_003555116.1|2.182610e-17369.17PREDICTED: uncharacterized protein LOC100815930 [G... [more]
gi|595937273|ref|XP_007215572.1|2.615790e-13854.88hypothetical protein PRUPE_ppa007489mg [Prunus per... [more]
gi|224127432|ref|XP_002329276.1|2.857060e-13552.82predicted protein [Populus trichocarpa][more]
gi|225451989|ref|XP_002279924.1|7.941140e-13551.34PREDICTED: uncharacterized protein LOC100256693 [V... [more]
gi|296087301|emb|CBI33675.3|4.745660e-13451.47unnamed protein product [Vitis vinifera][more]
gi|255551392|ref|XP_002516742.1|5.968520e-13353.85conserved hypothetical protein [Ricinus communis] ... [more]
gi|590653014|ref|XP_007033305.1|4.229650e-13054.47Rhomboid-related intramembrane serine protease fam... [more]
gi|470136741|ref|XP_004304142.1|1.598890e-12851.04PREDICTED: uncharacterized protein LOC101293506 [F... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D1.20.1540.10no descriptioncoord: 175..353
score: 2.2
NoneNo IPR availableSEGsegsegcoord: 36..45
score: NAcoord: 391..399
score
NoneNo IPR availableSUPERFAMILY144091Rhomboid-likecoord: 165..362
score: 1.6

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0260.1 ID=Medtr0024s0260.1|Name=Medtr0024s0260.1|organism=Medicago truncatula|type=mRNA|length=1266bp
ATGGCTGCATTTTCAGTATGTTACAGAACACCTTACAAGAACACATGCAT
AGTTTTTGGCAAAGATTCTATATACAAGACCGCGACAAAATTACGTGTTC
AGTGTTCATCAGAGTCTACCTCTACTGAGTCTGAGAAGAAACTAAGATCG
TTAGATTCTTATTTTGGAAAACTACAACATAAAACAAAATTACATGTTTC
TGATGCATCAAGTGAGGTGATGAAGGTGCACCAAGAAAATGGTCAATCTG
AATCAAATCATGAACTTGAGTCTCTTGATGAGTATCTTGGCAAGCTAAAT
AATGGCATAAACCAAGAATCTCTTGTGGCATCTTATGTTGAAAATTCCAA
GGATGAAAGTTTAGCTCCGAAACAAATTCTCAGCCAAGATACTCAAAGAA
CAAATTTTAGGAAACCAAATACTTATGTCAATATAAGAAGAATACAAGGT
GTTAGTGGTTCAATATCTGCTATAGATTCACATGATCAGCTAAATGATAC
ATCCAGTCTTTACCTCATAGGTATATTGGCATCAGTGAACATTGGAGTGT
TTCTATTTGAAATTGCAAGTCCTATAAGGAATAATAACTTAGAGCTGTTT
TCACTTCCAATGCTATATGGAGCAAAGATAAACCATTTGATCATGGTTGG
AGAATGGTGGAGGCTTATAACACCAATGTTTCTGCATGCAGGGATATTTC
ACATGGCTCTGAGTTGTTGGGCCCTTGTATCATTTGGGCCTCAAGTTTGC
AAAGGCTATGGTTCATTTACATTTTTCTTGATCTACATACTTGGTGGAGT
TTCTGGCAACTTGGCAAGTTTTCTACATACACCAGATCCAACTGTCGGTG
GCACCGGACCTGCATTTGCAATAATTGGTGCTTGGCTCATGTACCAAATT
CAAAATAGAGATGTTATTGAAAATGATGATTCTGATAATCTATTCAAGAA
GGCAATAATTATTACAGCTCTTGGTTTCATCTTATGCAACCTTGGTCCAA
TTGATGAGTGGTCACACTCGGGAGCAGCTTTCACAGGCATGGCATATGGC
TTTCTAACTAGTCCGGCTCTTCAGCTGGACGAGACATCACCTGGTACCGA
TGGAGAAGGACTCAAACTTGTTACAAAATACGGTGCTTCATGCAAATCAC
TTGTTATCTTTGCCATATTCGTCGTTGTTTTAAGTTCACTTCTTTTGTTT
ATGGATCCCCCTCTCAATGCATTGGCATCTGTTGTAGCCTTGGAATATAT
GTCAATATTTGGCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009507chloroplast
GO:0009526plastid envelope
GO:0009536plastid
GO:0009941chloroplast envelope
GO:0031090organelle membrane
GO:0031967organelle envelope
GO:0031969chloroplast membrane
GO:0031975envelope
GO:0042170plastid membrane
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044422organelle part
GO:0044424intracellular part
GO:0044434chloroplast part
GO:0044435plastid part
GO:0044444cytoplasmic part
GO:0044446intracellular organelle part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0040007growth
GO:0008150biological_process
GO:0010570regulation of filamentous growth
GO:0030447filamentous growth
GO:0040008regulation of growth
GO:0044182filamentous growth of a population of unicellular organisms
GO:0044699single-organism process
GO:0045926negative regulation of growth
GO:0048519negative regulation of biological process
GO:0050789regulation of biological process
GO:0060258negative regulation of filamentous growth
GO:0065007biological regulation
GO:1900428regulation of filamentous growth of a population of unicellular organisms
GO:1900429negative regulation of filamentous growth of a population of unicellular organisms