Overview
NameMedtr0024s0240.1
Unique NameMedtr0024s0240.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length507
Homology
BLAST of Medtr0024s0240.1 vs. NCBI nr
Match: gi|502162246|ref|XP_004512440.1| (PREDICTED: uncharacterized protein LOC101498235 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0240.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|502162246|ref|XP_004512440.1|3.117480e-957.38PREDICTED: uncharacterized protein LOC101498235 [C... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0240.1 ID=Medtr0024s0240.1|Name=Medtr0024s0240.1|organism=Medicago truncatula|type=mRNA|length=507bp
ATGGAAGCATCAAGGTTGGTTAATAACATTCATCCTCAACCACCTTCACT
TGATCATACGTATTCCATAAATGATTCCAATAAGTCTGGTGATGATGTTT
TCCGCCCAACAAGTTCAAGACCTAGCAATGGTGGGATAGGACACAAACCC
CATGCAAGAGCTATTCCTATAGTCTTATTGCAAAGTCCACAAACTCCTTC
ACTTAATCATAAGTATTCCATAAATGATGATAATAAGGACGGTGATGATT
TTTTCCACCCAACAAGTTCAGGACCTAGCAATGGTGGGATAGGACACAAA
CCCCATGCAAGAGATATTCCTATAGTCTTATTGCAAAGTTCACAACCTCC
TTCACTTAATCATAAGTATTCCATAATTGATGATAATAAGGATGGTGATG
ATGTTTTCCGCCCAACAAGTTCAGGACCTAGCAATGGTGGGATAGGGCAC
AAACCCTCGGCAAGAGCGATTCCTAGCGATGGGAATAGCCAAAAACATCA
CCATTAA
back to top