Overview
NameMedtr0024s0220.2
Unique NameMedtr0024s0220.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length330
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0007568 aging
biological_process GO:0008150 biological_process
biological_process GO:0008340 determination of adult lifespan
biological_process GO:0032502 developmental process
biological_process GO:0010259 multicellular organismal aging
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0003723 RNA binding
molecular_function GO:0005488 binding
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0003735 structural constituent of ribosome
molecular_function GO:0005198 structural molecule activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01248.2196557-9682613-1022-9186.54.2e-2986.75e-25

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0220.2 ID=Medtr0024s0220.2|Name=Medtr0024s0220.2|organism=Medicago truncatula|type=mRNA|length=330bp
ATGGTTGCTGCAAAGAAAACCAAGAAGACCCATGAGTCTATTAACAACAG
ACTCGCTCTTGTGATGAAGAGTGGGAAGTATACTTTGGGGTACAAAACTG
TTCTCAAATCTCTCAGGAACAACAAAGGGAAATTGATTATCATTGCTAAC
AATTGCCCACCATTGAGGAAGTCCGAGATTGAGTACTATGCTATGTTGGC
GAAGGTTGGAGTTCATCACTACAACGGGAACAATGTGGATCTTGGTACTG
CTTGCGGAAAATACTACAGAGTGTGCTGTCTCAGCATTGTTGATCCTGGT
AACATATTAATTACTCTACAATTATTCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0003723RNA binding
GO:0003735structural constituent of ribosome
GO:0005198structural molecule activity
GO:0005488binding
GO:0097159organic cyclic compound binding
GO:1901363heterocyclic compound binding
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0007568aging
GO:0008150biological_process
GO:0008340determination of adult lifespan
GO:0010259multicellular organismal aging
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process