Overview
NameMedtr0024s0220.1
Unique NameMedtr0024s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length339
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0007568 aging
biological_process GO:0008150 biological_process
biological_process GO:0008340 determination of adult lifespan
biological_process GO:0032502 developmental process
biological_process GO:0010259 multicellular organismal aging
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0003723 RNA binding
molecular_function GO:0005488 binding
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0003735 structural constituent of ribosome
molecular_function GO:0005198 structural molecule activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01248.2196557-9683513-1052-9490.32.7e-3090.53.1e-26

Homology
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|6094048|sp|O49884.1|RL30_LUPLU (RecName: Full=60S ribosomal protein L30 [Lupinus luteus] >gi|2879811|emb|CAA11256.1| ribosomal protein L30 [Lupinus luteus])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|156530455|gb|ABU75308.1| (ribosomal protein L30e [Pisum sativum])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|388510578|gb|AFK43355.1| (unknown [Lotus japonicus])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|502102290|ref|XP_004492027.1| (PREDICTED: 60S ribosomal protein L30-like [Cicer arietinum])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|460411609|ref|XP_004251199.1| (PREDICTED: 60S ribosomal protein L30-like [Solanum lycopersicum])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|363808218|ref|NP_001242744.1| (uncharacterized protein LOC100776662 [Glycine max] >gi|255635185|gb|ACU17948.1| unknown [Glycine max])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|356568893|ref|XP_003552642.1| (PREDICTED: 60S ribosomal protein L30-like [Glycine max] >gi|593331798|ref|XP_007139325.1| hypothetical protein PHAVU_008G019800g [Phaseolus vulgaris] >gi|561012458|gb|ESW11319.1| hypothetical protein PHAVU_008G019800g [Phaseolus vulgaris])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|502180636|ref|XP_004516683.1| (PREDICTED: 60S ribosomal protein L30-like [Cicer arietinum])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|356536572|ref|XP_003536811.1| (PREDICTED: 60S ribosomal protein L30-like [Glycine max] >gi|571468909|ref|XP_006584500.1| PREDICTED: uncharacterized protein LOC100499680 isoform X1 [Glycine max])
BLAST of Medtr0024s0220.1 vs. NCBI nr
Match: gi|255638395|gb|ACU19508.1| (unknown [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|6094048|sp|O49884.1|RL30_LUPLU1.653420e-7397.32RecName: Full=60S ribosomal protein L30 [Lupinus l... [more]
gi|156530455|gb|ABU75308.1|2.079200e-7397.32ribosomal protein L30e [Pisum sativum][more]
gi|388510578|gb|AFK43355.1|2.558170e-7396.43unknown [Lotus japonicus][more]
gi|502102290|ref|XP_004492027.1|5.862170e-7395.54PREDICTED: 60S ribosomal protein L30-like [Cicer a... [more]
gi|460411609|ref|XP_004251199.1|6.190850e-7395.54PREDICTED: 60S ribosomal protein L30-like [Solanum... [more]
gi|363808218|ref|NP_001242744.1|8.043990e-7396.43uncharacterized protein LOC100776662 [Glycine max]... [more]
gi|356568893|ref|XP_003552642.1|9.474290e-7395.54PREDICTED: 60S ribosomal protein L30-like [Glycine... [more]
gi|502180636|ref|XP_004516683.1|1.531190e-7296.43PREDICTED: 60S ribosomal protein L30-like [Cicer a... [more]
gi|356536572|ref|XP_003536811.1|1.652710e-7294.64PREDICTED: 60S ribosomal protein L30-like [Glycine... [more]
gi|255638395|gb|ACU19508.1|2.447770e-7295.54unknown [Glycine max][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR022991Ribosomal protein L30e, conserved sitePROSITEPS00993RIBOSOMAL_L30E_2coord: 80..100
score
NoneNo IPR availableGENE3D3.30.1330.30no descriptioncoord: 12..109
score: 1.6
NoneNo IPR availableSUPERFAMILY55315L30e-likecoord: 10..108
score: 6.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0220.1 ID=Medtr0024s0220.1|Name=Medtr0024s0220.1|organism=Medicago truncatula|type=mRNA|length=339bp
ATGGTTGCTGCAAAGAAAACCAAGAAGACCCATGAGTCTATTAACAACAG
ACTCGCTCTTGTGATGAAGAGTGGGAAGTATACTTTGGGGTACAAAACTG
TTCTCAAATCTCTCAGGAACAACAAAGGGAAATTGATTATCATTGCTAAC
AATTGCCCACCATTGAGGAAGTCCGAGATTGAGTACTATGCTATGTTGGC
GAAGGTTGGAGTTCATCACTACAACGGGAACAATGTGGATCTTGGTACTG
CTTGCGGAAAATACTACAGAGTGTGCTGTCTCAGCATTGTTGATCCTGGT
GATTCTGATATCATCAAGACCATACCTGGAGACCAATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR022991Ribosomal protein L30e, conserved site
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0003723RNA binding
GO:0003735structural constituent of ribosome
GO:0005198structural molecule activity
GO:0005488binding
GO:0097159organic cyclic compound binding
GO:1901363heterocyclic compound binding
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0007568aging
GO:0008150biological_process
GO:0008340determination of adult lifespan
GO:0010259multicellular organismal aging
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process