Overview
NameMedtr0024s0190.1
Unique NameMedtr0024s0190.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1224
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0044255 cellular lipid metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0045017 glycerolipid biosynthetic process
biological_process GO:0046486 glycerolipid metabolic process
biological_process GO:0008610 lipid biosynthetic process
biological_process GO:0006629 lipid metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0044711 single-organism biosynthetic process
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0008374 O-acyltransferase activity
molecular_function GO:0016411 acylglycerol O-acyltransferase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0004144 diacylglycerol O-acyltransferase activity
molecular_function GO:0047196 long-chain-alcohol O-fatty-acyltransferase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016740 transferase activity
molecular_function GO:0016746 transferase activity, transferring acyl groups
molecular_function GO:0016747 transferase activity, transferring acyl groups other than amino-acyl groups
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03007.1179742-7925437-19994-26347.32.4e-1649.34.1e-13
PF06974.879106-78651249-4003-15291.08.3e-3092.12.6e-26

Homology
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|502180632|ref|XP_004516682.1| (PREDICTED: O-acyltransferase WSD1-like [Cicer arietinum])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|502180628|ref|XP_004516681.1| (PREDICTED: O-acyltransferase WSD1-like [Cicer arietinum])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|356545712|ref|XP_003541280.1| (PREDICTED: O-acyltransferase WSD1-like [Glycine max])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|359806773|ref|NP_001241558.1| (uncharacterized protein LOC100777968 [Glycine max] >gi|255635441|gb|ACU18073.1| unknown [Glycine max])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|502180624|ref|XP_004516680.1| (PREDICTED: O-acyltransferase WSD1-like [Cicer arietinum])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|502180659|ref|XP_004516688.1| (PREDICTED: O-acyltransferase WSD1-like [Cicer arietinum])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|225446392|ref|XP_002274522.1| (PREDICTED: O-acyltransferase WSD1 [Vitis vinifera])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|302143306|emb|CBI21867.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|595883077|ref|XP_007212723.1| (hypothetical protein PRUPE_ppa018856mg [Prunus persica] >gi|462408588|gb|EMJ13922.1| hypothetical protein PRUPE_ppa018856mg [Prunus persica])
BLAST of Medtr0024s0190.1 vs. NCBI nr
Match: gi|255553705|ref|XP_002517893.1| (conserved hypothetical protein [Ricinus communis] >gi|223542875|gb|EEF44411.1| conserved hypothetical protein [Ricinus communis])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0190.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180632|ref|XP_004516682.1|0.000000e+092.61PREDICTED: O-acyltransferase WSD1-like [Cicer arie... [more]
gi|502180628|ref|XP_004516681.1|0.000000e+078.32PREDICTED: O-acyltransferase WSD1-like [Cicer arie... [more]
gi|356545712|ref|XP_003541280.1|0.000000e+073.02PREDICTED: O-acyltransferase WSD1-like [Glycine ma... [more]
gi|359806773|ref|NP_001241558.1|0.000000e+072.52uncharacterized protein LOC100777968 [Glycine max]... [more]
gi|502180624|ref|XP_004516680.1|0.000000e+066.33PREDICTED: O-acyltransferase WSD1-like [Cicer arie... [more]
gi|502180659|ref|XP_004516688.1|0.000000e+066.58PREDICTED: O-acyltransferase WSD1-like [Cicer arie... [more]
gi|225446392|ref|XP_002274522.1|5.518400e-17257.75PREDICTED: O-acyltransferase WSD1 [Vitis vinifera][more]
gi|302143306|emb|CBI21867.3|5.150010e-17157.75unnamed protein product [Vitis vinifera][more]
gi|595883077|ref|XP_007212723.1|5.636190e-17159.31hypothetical protein PRUPE_ppa018856mg [Prunus per... [more]
gi|255553705|ref|XP_002517893.1|2.276140e-16858.35conserved hypothetical protein [Ricinus communis] ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0190.1 ID=Medtr0024s0190.1|Name=Medtr0024s0190.1|organism=Medicago truncatula|type=mRNA|length=1224bp
ATGGACCAATTCGATGGAGAGAAAAAATGGAAGAAAGTTGAAGTTAACTT
GGAAGAACATATTAAAGTTCCTGAATTTCCAAGTGACAAATCATCCAACT
CATTCTATGATGAACATCTTGATGATTATATGTCCAAAATAGCAATGGAA
CATTTACCACAAGATAGACCACTTTGGGAGATACATATTATTAAATATCC
AACAAAAAATGCAGCTGGTACCTTAGTATTCAAACTTCATCATGCACTTG
GAGATGGTTACTCTCTAATGGGTGCACTTCTTTCATGTTTAGAAAGAGCT
GATAACCCTTCTCTTCCATTCACATTACCATCAAGTAAAATTAGACCTAA
GTCTATTTTTAATACCAAAGCAATTATCAAGAGATTTCCCTCTATTTTCT
CATCAACAATTTGGTCTATGTTGGATTTTGGATGGAGTATTTTGAAAAGT
AGCATGATTGAAGATGACCTAACACCAATTAGGTCACGTGCTGATGATGT
CAAGCTTCGACAAATTACTATCTCAAATGTTTCATTCACTATGGAGCATA
TCAAAGAAGTGAAAACAAGACTTGGAGTGAGCATAAATGATGTGATTGCT
GGATTAATTTTCTTTGGCATTCGGTTATACATGCTAGAAGTTAATAAGGA
ATCAAGAAAAGCTAACTCTACAGCACTTGTCTTGCTAAATACAAGAAATA
TCAAGGGTTATAAATCTGTTAAGGAAATGGTTAGCAAGAACAATAATGGT
GCTGCTTGGGGGAATCAATTTGCATTTTTGCATGTACCAATTCCAGAGCT
TAATGATCCTAAATTTGAAAATCCACTTGAATTTATTTGGGAAGCTCATA
AAGAAATCAGCAGGAAGAAAAATTCTTTGGTTACACCTCTTACTGGCATG
CTCTTAAATATGGTGAAAACACTCAGAGGCCCTGAGGCTGCAGCTAGATA
TGTACACAGTACTTTAAGAAACTCAAGTACAACAATCTCAAACATCATTG
GGCCAGTGGAGCAAATGGCTTTGGCTAATCATCCAGTTAAAGGTCTATAC
TTCATGGTTGTTGGTCCACCAGAGAGTCTCACAGTAACGATCATGAGCTA
TATGGGAAAGTTAAGAATTGCATTTGGTTCAGAGAAAGATTTCATTGACA
AGCAAAAAATCAAGTGCTGTATGGAGAAATCTCTTGAGATGATAATTAAA
GCATCAAGAAAGACTTCAACATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006629lipid metabolic process
GO:0008150biological_process
GO:0008610lipid biosynthetic process
GO:0009058biosynthetic process
GO:0009987cellular process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044249cellular biosynthetic process
GO:0044255cellular lipid metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044711single-organism biosynthetic process
GO:0044763single-organism cellular process
GO:0045017glycerolipid biosynthetic process
GO:0046486glycerolipid metabolic process
GO:0071704organic substance metabolic process
GO:1901576organic substance biosynthetic process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004144diacylglycerol O-acyltransferase activity
GO:0008374O-acyltransferase activity
GO:0016411acylglycerol O-acyltransferase activity
GO:0016740transferase activity
GO:0016746transferase activity, transferring acyl groups
GO:0016747transferase activity, transferring acyl groups other than amino-acyl groups
GO:0047196long-chain-alcohol O-fatty-acyltransferase activity