Overview
NameMedtr0024s0180.1
Unique NameMedtr0024s0180.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length375
Homology
BLAST of Medtr0024s0180.1 vs. NCBI nr
Match: gi|400131576|emb|CCH50976.1| (T4.15 [Malus x robusta])
BLAST of Medtr0024s0180.1 vs. NCBI nr
Match: gi|342365838|gb|AEL30371.1| (TIR-NBS-LRR type disease resistance protein [Arachis hypogaea])
BLAST of Medtr0024s0180.1 vs. NCBI nr
Match: gi|474039782|gb|EMS53252.1| (Putative protein phosphatase 2C 76 [Triticum urartu])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0180.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 3
Match NameE-valueIdentityDescription
gi|400131576|emb|CCH50976.1|1.570490e-539.39T4.15 [Malus x robusta][more]
gi|342365838|gb|AEL30371.1|2.644200e-433.82TIR-NBS-LRR type disease resistance protein [Arach... [more]
gi|474039782|gb|EMS53252.1|4.648260e-435.00Putative protein phosphatase 2C 76 [Triticum urart... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0180.1 ID=Medtr0024s0180.1|Name=Medtr0024s0180.1|organism=Medicago truncatula|type=mRNA|length=375bp
ATGGATGTAAGGGTTAAGAGAAGTGCAAAGAGAAGAAGTCATAGCGGGGC
TTTGCTAATCAATTGGTGGCATTTAAAGGGTGAAAAACAAAGAATTTTCC
AACACAAGATCTTAAAGGGATGTTTCATGCAACCACAAGGAAGCGCTAAA
GATATGTGGGAGAAGATGGCACATGAGATTAAAGAAGTAGCAAAGCAACG
TTGGAAGATTCAAGAGATTTTGGACCTAGAGGTGAAGAATTTTGGTGGTG
GAATGACAATGTTCAAAGTAAAGCTCGAATCAAAAGAGATTATTTCAAAG
ACTGACCTAGGTGTCAAAATGTCGAAACTTGGGGTAAATATAAGATATAT
AGGAAAGAGGCTAAGAAGGTGGTGA
back to top