Overview
NameMedtr0024s0160.1
Unique NameMedtr0024s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length435
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006259 DNA metabolic process
biological_process GO:0006281 DNA repair
biological_process GO:0008150 biological_process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0044267 cellular protein metabolic process
biological_process GO:0006464 cellular protein modification process
biological_process GO:0006974 cellular response to DNA damage stimulus
biological_process GO:0051716 cellular response to stimulus
biological_process GO:0033554 cellular response to stress
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0043412 macromolecule modification
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0019538 protein metabolic process
biological_process GO:0032446 protein modification by small protein conjugation
biological_process GO:0070647 protein modification by small protein conjugation or removal
biological_process GO:0036211 protein modification process
biological_process GO:0016567 protein ubiquitination
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00415.1365088-6524976-1293-5132.16.4e-1268.05.2e-19

Homology
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|502180620|ref|XP_004516679.1| (PREDICTED: ultraviolet-B receptor UVR8-like [Cicer arietinum])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|356573964|ref|XP_003555124.1| (PREDICTED: E3 ubiquitin-protein ligase HERC2-like [Glycine max])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|255551398|ref|XP_002516745.1| (Ran GTPase binding protein, putative [Ricinus communis] >gi|223544118|gb|EEF45643.1| Ran GTPase binding protein, putative [Ricinus communis])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|595935453|ref|XP_007215499.1| (hypothetical protein PRUPE_ppa006886mg [Prunus persica] >gi|462411649|gb|EMJ16698.1| hypothetical protein PRUPE_ppa006886mg [Prunus persica])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|595935460|ref|XP_007215500.1| (hypothetical protein PRUPE_ppa006886mg [Prunus persica] >gi|462411650|gb|EMJ16699.1| hypothetical protein PRUPE_ppa006886mg [Prunus persica])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|470136737|ref|XP_004304140.1| (PREDICTED: probable E3 ubiquitin-protein ligase HERC4-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|590652998|ref|XP_007033301.1| (Regulator of chromosome condensation (RCC1) family protein [Theobroma cacao] >gi|508712330|gb|EOY04227.1| Regulator of chromosome condensation (RCC1) family protein [Theobroma cacao])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|15237253|ref|NP_197108.1| (regulator of chromosome condensation repeat-containing protein [Arabidopsis thaliana] >gi|9755650|emb|CAC01803.1| UVB-resistance protein-like [Arabidopsis thaliana] >gi|114213505|gb|ABI54335.1| At5g16040 [Arabidopsis thaliana] >gi|332004857|gb|AED92240.1| regulator of chromosome condensation repeat-containing protein [Arabidopsis thaliana])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|297811737|ref|XP_002873752.1| (regulator of chromosome condensation family protein [Arabidopsis lyrata subsp. lyrata] >gi|297319589|gb|EFH50011.1| regulator of chromosome condensation family protein [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0024s0160.1 vs. NCBI nr
Match: gi|565453826|ref|XP_006286629.1| (hypothetical protein CARUB_v10002448mg [Capsella rubella] >gi|482555335|gb|EOA19527.1| hypothetical protein CARUB_v10002448mg [Capsella rubella])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180620|ref|XP_004516679.1|4.277610e-4770.77PREDICTED: ultraviolet-B receptor UVR8-like [Cicer... [more]
gi|356573964|ref|XP_003555124.1|1.346020e-4569.29PREDICTED: E3 ubiquitin-protein ligase HERC2-like ... [more]
gi|255551398|ref|XP_002516745.1|2.310210e-4566.67Ran GTPase binding protein, putative [Ricinus comm... [more]
gi|595935453|ref|XP_007215499.1|3.213500e-4567.46hypothetical protein PRUPE_ppa006886mg [Prunus per... [more]
gi|595935460|ref|XP_007215500.1|3.247440e-4567.46hypothetical protein PRUPE_ppa006886mg [Prunus per... [more]
gi|470136737|ref|XP_004304140.1|1.071370e-4364.62PREDICTED: probable E3 ubiquitin-protein ligase HE... [more]
gi|590652998|ref|XP_007033301.1|1.074530e-4367.97Regulator of chromosome condensation (RCC1) family... [more]
gi|15237253|ref|NP_197108.1|4.418170e-4363.16regulator of chromosome condensation repeat-contai... [more]
gi|297811737|ref|XP_002873752.1|9.777150e-4362.41regulator of chromosome condensation family protei... [more]
gi|565453826|ref|XP_006286629.1|1.192380e-4261.65hypothetical protein CARUB_v10002448mg [Capsella r... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000408Regulator of chromosome condensation, RCC1PROFILEPS50012RCC1_3coord: 16..70
score: 10.444coord: 75..132
score: 10
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein IIGENE3D2.130.10.30no descriptioncoord: 18..130
score: 2.2
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein IISUPERFAMILY50985RCC1/BLIP-IIcoord: 18..136
score: 1.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0160.1 ID=Medtr0024s0160.1|Name=Medtr0024s0160.1|organism=Medicago truncatula|type=mRNA|length=435bp
ATGTATGATTCAACATTTCACAATGTTCCCTACTCAAAGCTTCATGTTCT
TGTATATGGGTGGGGAAGGGGTGAACATGGTAGGCTTGGATTTGGTGATA
GTGATAAGAGCAGTAAAATGTTACCTCAGAGGGTTCAACTTTTAGCCGGT
GAAGATATTGTTCAGCATAGGTATCATGGTTATGAAACAATAGTCACTTT
GATAGTGGAAATGGTTTCGCCTTCACAAATATTTTCTTTTGGGAGAGGTG
ATCATGGGCGTCTTGGATATGGGAGGAAAGTCACTACTGGTCAACCAATG
GAGAATCTCGGTGATGCTGACGGTGAAGCTGAGGGAAATTGGATAGCCAA
ACTCGTCGATTGTGGTGGCCGCCATACTTTGGCAATAGTAGAATGGAAAG
ATGATGAATCTAAAGACGAATCTATTCATGATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000408Regulator of chromosome condensation, RCC1
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein II
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0016567protein ubiquitination
GO:0006139nucleobase-containing compound metabolic process
GO:0006259DNA metabolic process
GO:0006281DNA repair
GO:0006464cellular protein modification process
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0006950response to stress
GO:0006974cellular response to DNA damage stimulus
GO:0008150biological_process
GO:0009987cellular process
GO:0019538protein metabolic process
GO:0033554cellular response to stress
GO:0032446protein modification by small protein conjugation
GO:0034641cellular nitrogen compound metabolic process
GO:0036211protein modification process
GO:0043170macromolecule metabolic process
GO:0043412macromolecule modification
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044260cellular macromolecule metabolic process
GO:0044267cellular protein metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0046483heterocycle metabolic process
GO:0050896response to stimulus
GO:0051716cellular response to stimulus
GO:0070647protein modification by small protein conjugation or removal
GO:0071704organic substance metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process