Overview
NameMedtr0024s0150.1
Unique NameMedtr0024s0150.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length702
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0022607 cellular component assembly
biological_process GO:0044085 cellular component biogenesis
biological_process GO:0016043 cellular component organization
biological_process GO:0071840 cellular component organization or biogenesis
biological_process GO:0034622 cellular macromolecular complex assembly
biological_process GO:0043623 cellular protein complex assembly
biological_process GO:0017004 cytochrome complex assembly
biological_process GO:0065003 macromolecular complex assembly
biological_process GO:0043933 macromolecular complex subunit organization
biological_process GO:0006461 protein complex assembly
biological_process GO:0070271 protein complex biogenesis
biological_process GO:0071822 protein complex subunit organization
biological_process GO:0008535 respiratory chain complex IV assembly
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0043226 organelle
Homology
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|442803231|gb|AGC78966.1| (hypothetical protein (mitochondrion) [Vicia faba] >gi|442803258|gb|AGC78993.1| hypothetical protein (mitochondrion) [Vicia faba])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|320148074|emb|CBJ20736.1| (hypothetical protein [Beta vulgaris subsp. maritima])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|323435166|ref|YP_004222385.1| (hypothetical protein BevumaM_p152 [Beta vulgaris subsp. maritima] >gi|346683259|ref|YP_004842191.1| hypothetical protein BemaM_p147 [Beta macrocarpa] >gi|317905618|emb|CBX33220.1| hypothetical protein [Beta vulgaris subsp. maritima] >gi|319439899|emb|CBX33314.1| hypothetical protein [Beta vulgaris subsp. maritima] >gi|345500177|emb|CBX24996.1| hypothetical protein [Beta macrocarpa] >gi|384939165|emb|CBL52012.1| hypothetical protein (mitochondrion) [Beta vulgaris subsp. maritima])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|442803230|gb|AGC78965.1| (cytochrome c biogenesis FC (mitochondrion) [Vicia faba] >gi|442803257|gb|AGC78992.1| cytochrome c biogenesis FC (mitochondrion) [Vicia faba])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|224108171|ref|XP_002333424.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|224167073|ref|XP_002338995.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|476507683|ref|YP_007516870.1| (cytochrome c biogenesis FC (mitochondrion) [Glycine max] >gi|403311561|gb|AFR34309.1| cytochrome c biogenesis FC (mitochondrion) [Glycine max])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|459537|emb|CAA54966.1| (unnamed protein product [Oenothera berteroana] >gi|1581174|prf||2116373A ORF 454)
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|386799234|ref|YP_006291801.1| (ccmFc gene product (mitochondrion) [Daucus carota subsp. sativus] >gi|374081937|gb|AEY81129.1| cytochrome c biogenesis FC (mitochondrion) [Daucus carota subsp. sativus])
BLAST of Medtr0024s0150.1 vs. NCBI nr
Match: gi|320148075|emb|CBJ20737.1| (hypothetical protein [Beta vulgaris subsp. maritima])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0150.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|442803231|gb|AGC78966.1|4.842120e-14795.69hypothetical protein (mitochondrion) [Vicia faba] ... [more]
gi|320148074|emb|CBJ20736.1|3.858380e-13287.02hypothetical protein [Beta vulgaris subsp. maritim... [more]
gi|323435166|ref|YP_004222385.1|1.462970e-13187.02hypothetical protein BevumaM_p152 [Beta vulgaris s... [more]
gi|442803230|gb|AGC78965.1|8.665880e-12692.15cytochrome c biogenesis FC (mitochondrion) [Vicia ... [more]
gi|224108171|ref|XP_002333424.1|1.536250e-12488.18predicted protein [Populus trichocarpa][more]
gi|224167073|ref|XP_002338995.1|8.462160e-12390.43predicted protein [Populus trichocarpa][more]
gi|476507683|ref|YP_007516870.1|1.184640e-12189.53cytochrome c biogenesis FC (mitochondrion) [Glycin... [more]
gi|459537|emb|CAA54966.1|1.343810e-12185.86unnamed protein product [Oenothera berteroana] >gi... [more]
gi|386799234|ref|YP_006291801.1|2.108940e-12186.36ccmFc gene product (mitochondrion) [Daucus carota ... [more]
gi|320148075|emb|CBJ20737.1|7.388320e-12087.30hypothetical protein [Beta vulgaris subsp. maritim... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 189..197
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0150.1 ID=Medtr0024s0150.1|Name=Medtr0024s0150.1|organism=Medicago truncatula|type=mRNA|length=702bp
ATGAGGCAGAAACTCGCCCCAAGTACGGTTCGGAGGCCAAGCCCCACCCC
AGCAGTAATGGTGCGGCTTAGGTCAACTAACACAAAGAAGATACAGTTCA
CTCAACGATTGCCTTTGGGTTCCGAACTCCATATAGGGAAGGAGCGTTGT
TGTTTCCGAGGTCTCGATCATTTACATGGACCCACTTCTCATTCCATTTG
TGGGAATTTGATGATCTATAAACCGTCCCTAACAAACGATCGCCTCATGT
TTGAGCATGATGAATCACTTCGTGCCGACCTATTGCCAATAAACTTTCCG
GCCTCATATGAGAATGGAAATCTGGATAATTTTCTGCATCGGTGGATGAA
GAATAGCGAAAATAATAATTTATGGTTGACCATGTTCCCAGAAAAAAAAT
ACTTTAGAGAAACAACGAGCACGACTGAAGTGGCTATACATACAAATCCA
TTTACGGATAGATATGCTTCGATTGGAACTGAAAGTTCCAGAACAGGCGG
CTGGTATACCACCATAATTAAACTACCTTTTATTTTGTTTATTCGGATAG
GATTTATGTTGGCTTCGTCGGGAGGCTCGAGTAGTTTGTTACGTCAGCTC
CAAAAGGATAAGTTGCGTTGGAATCGAGAAAGTTCCGTGGAATTCTTAAT
TGCATTAAAAAAATCAAAGGAGTCTTCAACCCTCTCAATCAATAGAGGCT
AG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006461protein complex assembly
GO:0008150biological_process
GO:0008535respiratory chain complex IV assembly
GO:0022607cellular component assembly
GO:0016043cellular component organization
GO:0017004cytochrome complex assembly
GO:0034622cellular macromolecular complex assembly
GO:0043623cellular protein complex assembly
GO:0043933macromolecular complex subunit organization
GO:0044085cellular component biogenesis
GO:0065003macromolecular complex assembly
GO:0070271protein complex biogenesis
GO:0071822protein complex subunit organization
GO:0071840cellular component organization or biogenesis