Overview
NameMedtr0024s0130.1
Unique NameMedtr0024s0130.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length255
Homology
BLAST of Medtr0024s0130.1 vs. NCBI nr
Match: gi|147791177|emb|CAN61461.1| (hypothetical protein VITISV_029800 [Vitis vinifera])
BLAST of Medtr0024s0130.1 vs. NCBI nr
Match: gi|255555148|ref|XP_002518611.1| (conserved hypothetical protein [Ricinus communis] >gi|223542210|gb|EEF43753.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0024s0130.1 vs. NCBI nr
Match: gi|91806526|gb|ABE65990.1| (hypothetical protein At3g44470 [Arabidopsis thaliana])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0130.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 3
Match NameE-valueIdentityDescription
gi|147791177|emb|CAN61461.1|4.323110e-2992.86hypothetical protein VITISV_029800 [Vitis vinifera... [more]
gi|255555148|ref|XP_002518611.1|3.007880e-2886.44conserved hypothetical protein [Ricinus communis] ... [more]
gi|91806526|gb|ABE65990.1|1.513900e-973.68hypothetical protein At3g44470 [Arabidopsis thalia... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0130.1 ID=Medtr0024s0130.1|Name=Medtr0024s0130.1|organism=Medicago truncatula|type=mRNA|length=255bp
ATGGAAGCGGGCGGGCTGTTAGAAGTTCGGCCCGTTTTTTTTGGTGTCGT
AGTGGAGGGATTGACCTTTTTAACGCATATTCACTCGTACCGGCATGGCC
CCACTGATTTGTTTTCGATCGGAGCATCAAGCAGCGCAACCCGGTTCTAC
TTGACTAAGCCCCGTGCTCGTCCAAGGAGGGAGTTTGCTCTACCCAACTC
CCTTTTTGATAACAATGCAGAAACCCCCGACCCGACATTCATTAGTTTCG
AATGA
back to top