Overview
NameMedtr0024s0110.1
Unique NameMedtr0024s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length531
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0009060 aerobic respiration
biological_process GO:0008150 biological_process
biological_process GO:0040007 growth
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0016021 integral component of membrane
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005739 mitochondrion
cellular_component GO:0043226 organelle
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009055 electron carrier activity
molecular_function GO:0004519 endonuclease activity
molecular_function GO:0020037 heme binding
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0016788 hydrolase activity, acting on ester bonds
molecular_function GO:0005506 iron ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0004518 nuclease activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00115.1550782-5092564-111207-25445.91.9e-16105.81.8e-30

Homology
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|16265442|gb|AAL16466.1| (cytochrome c oxidase subunit I, partial (mitochondrion) [Hypseleotris compressa])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|425862537|gb|AFY03536.1| (cytochrome c oxidase subunit 1, partial (mitochondrion) [Lagenaria siceraria])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|187962363|gb|ACD44509.1| (cytochrome oxidase subunit 1, partial (mitochondrion) [Silene latifolia])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|187962121|gb|ACD44388.1| (cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharum] >gi|187962123|gb|ACD44389.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharinum] >gi|187962125|gb|ACD44390.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer negundo] >gi|187962127|gb|ACD44391.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer negundo] >gi|187962129|gb|ACD44392.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer platanoides] >gi|187962131|gb|ACD44393.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer platanoides] >gi|187962133|gb|ACD44394.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer rubrum] >gi|187962135|gb|ACD44395.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer rubrum] >gi|187962137|gb|ACD44396.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer rubrum] >gi|187962139|gb|ACD44397.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharinum] >gi|187962141|gb|ACD44398.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharinum] >gi|187962143|gb|ACD44399.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharinum] >gi|187962145|gb|ACD44400.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharum] >gi|187962147|gb|ACD44401.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Acer saccharum] >gi|187962293|gb|ACD44474.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus alba] >gi|187962295|gb|ACD44475.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus alba] >gi|187962297|gb|ACD44476.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus alba] >gi|187962299|gb|ACD44477.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus alba] >gi|187962301|gb|ACD44478.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus macrocarpa] >gi|187962303|gb|ACD44479.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus macrocarpa] >gi|187962305|gb|ACD44480.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus rubra] >gi|187962307|gb|ACD44481.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus rubra] >gi|187962309|gb|ACD44482.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus rubra] >gi|187962311|gb|ACD44483.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Quercus velutina])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|46850056|gb|AAT02450.1| (cytochrome oxidase subunit I [Byblis liniflora])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|187962149|gb|ACD44402.1| (cytochrome oxidase subunit 1, partial (mitochondrion) [Betula alleghaniensis] >gi|187962151|gb|ACD44403.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Betula alleghaniensis] >gi|187962153|gb|ACD44404.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Betula papyrifera] >gi|187962155|gb|ACD44405.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Betula papyrifera] >gi|187962157|gb|ACD44406.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Betula papyrifera])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|46850054|gb|AAT02449.1| (cytochrome oxidase subunit I [Cephalotus follicularis])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|46850100|gb|AAT02472.1| (cytochrome oxidase subunit I [Genlisea violacea])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|20453851|gb|AAM22160.1|AF482513_1 (cytochrome C oxidase subunit I [Columnea sp. Lindqvist & Albert 30])
BLAST of Medtr0024s0110.1 vs. NCBI nr
Match: gi|187962365|gb|ACD44510.1| (cytochrome oxidase subunit 1, partial (mitochondrion) [Solanum dulcamara] >gi|187962367|gb|ACD44511.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Solanum dulcamara] >gi|187962369|gb|ACD44512.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Solanum dulcamara] >gi|187962371|gb|ACD44513.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Solanum nigrum] >gi|187962373|gb|ACD44514.1| cytochrome oxidase subunit 1, partial (mitochondrion) [Solanum nigrum])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|16265442|gb|AAL16466.1|2.700060e-4372.38cytochrome c oxidase subunit I, partial (mitochond... [more]
gi|425862537|gb|AFY03536.1|2.842890e-3498.44cytochrome c oxidase subunit 1, partial (mitochond... [more]
gi|187962363|gb|ACD44509.1|6.936760e-3498.44cytochrome oxidase subunit 1, partial (mitochondri... [more]
gi|187962121|gb|ACD44388.1|1.197910e-3398.44cytochrome oxidase subunit 1, partial (mitochondri... [more]
gi|46850056|gb|AAT02450.1|1.230240e-3398.44cytochrome oxidase subunit I [Byblis liniflora][more]
gi|187962149|gb|ACD44402.1|1.236640e-3398.44cytochrome oxidase subunit 1, partial (mitochondri... [more]
gi|46850054|gb|AAT02449.1|1.256600e-3398.44cytochrome oxidase subunit I [Cephalotus follicula... [more]
gi|46850100|gb|AAT02472.1|1.256600e-3398.44cytochrome oxidase subunit I [Genlisea violacea][more]
gi|20453851|gb|AAM22160.1|AF482513_11.273360e-3398.44cytochrome C oxidase subunit I [Columnea sp. Lindq... [more]
gi|187962365|gb|ACD44510.1|1.317880e-3398.44cytochrome oxidase subunit 1, partial (mitochondri... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000883Cytochrome c oxidase, subunit IPRINTSPR01165CYCOXIDASEIcoord: 10..34
score: 3.4e-18coord: 52..64
score: 3.4
IPR000883Cytochrome c oxidase, subunit IGENE3D1.20.210.10no descriptioncoord: 1..64
score: 3e-28coord: 65..113
score: 7
IPR000883Cytochrome c oxidase, subunit IPROFILEPS50855COX1coord: 1..64
score: 16.563coord: 65..107
score: 12
IPR000883Cytochrome c oxidase, subunit ISUPERFAMILY81442Cytochrome c oxidase subunit I-likecoord: 1..115
score: 1.4
NoneNo IPR availableSEGsegsegcoord: 31..47
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0110.1 ID=Medtr0024s0110.1|Name=Medtr0024s0110.1|organism=Medicago truncatula|type=mRNA|length=531bp
ATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTTAT
AGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGT
TGTTGCCACCAAGTCTCTTTCTCCTATTAAGCTCAGCCTTAGTAGAGGTG
GGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGAGGGGGAGA
CCCCATATTATACCAGCATCTCTTTCGGTTCTTCAGTCATCCAGAGGTGT
ATATTCCAATTCTTCCTGGATCCGGTATCATAAGTCATATCGTTTCGACT
TTTTCGGGAAAACCGGTCTTCAGGGTTCATCTTTTTGTTCACCATAGGAG
GACTCACTGGAATAGTCCCGGCAAATTCAGGGCTAGATATGCCGGATTCA
TCTTAAACCGACCGATATGCCGAGATGACATCCAGCACGAGAGCAAGAAA
AGGAAATGGTCTCCGTGCAGCTTCAAGTCACGCCACTCTCACCAAGATAG
AATCATGGTCACATCTGTAGTATATATCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000883Cytochrome c oxidase, subunit I
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005506iron ion binding
GO:0009055electron carrier activity
GO:0020037heme binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004518nuclease activity
GO:0004519endonuclease activity
GO:0016787hydrolase activity
GO:0016788hydrolase activity, acting on ester bonds
Vocabulary: Biological Process
TermDefinition
GO:0009060aerobic respiration
GO:0040007growth
GO:0008150biological_process
Vocabulary: Cellular Component
TermDefinition
GO:0016021integral component of membrane
GO:0005622intracellular
GO:0005575cellular_component
GO:0005739mitochondrion
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part