Overview
NameMedtr0024s0080.1
Unique NameMedtr0024s0080.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1239
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03140.1035779-3466727-3971-391344.16.7e-107344.38e-103

Homology
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|502132341|ref|XP_004501312.1| (PREDICTED: UPF0481 protein At3g47200-like [Cicer arietinum])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356509930|ref|XP_003523695.1| (PREDICTED: UPF0481 protein At3g47200-like [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356509926|ref|XP_003523693.1| (PREDICTED: putative UPF0481 protein At3g02645-like isoform X1 [Glycine max] >gi|571449475|ref|XP_006578152.1| PREDICTED: putative UPF0481 protein At3g02645-like isoform X2 [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356515270|ref|XP_003526324.1| (PREDICTED: UPF0481 protein At3g47200-like [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356515284|ref|XP_003526331.1| (PREDICTED: putative UPF0481 protein At3g02645-like [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356515264|ref|XP_003526321.1| (PREDICTED: UPF0481 protein At3g47200-like [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|502134080|ref|XP_004501993.1| (PREDICTED: UPF0481 protein At3g47200-like [Cicer arietinum])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356577420|ref|XP_003556824.1| (PREDICTED: UPF0481 protein At3g47200-like [Glycine max])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|255548970|ref|XP_002515541.1| (conserved hypothetical protein [Ricinus communis] >gi|223545485|gb|EEF46990.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0024s0080.1 vs. NCBI nr
Match: gi|356515272|ref|XP_003526325.1| (PREDICTED: UPF0481 protein At3g47200-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0080.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502132341|ref|XP_004501312.1|7.030710e-16764.00PREDICTED: UPF0481 protein At3g47200-like [Cicer a... [more]
gi|356509930|ref|XP_003523695.1|2.977090e-16660.05PREDICTED: UPF0481 protein At3g47200-like [Glycine... [more]
gi|356509926|ref|XP_003523693.1|1.760060e-15956.81PREDICTED: putative UPF0481 protein At3g02645-like... [more]
gi|356515270|ref|XP_003526324.1|1.186330e-14355.39PREDICTED: UPF0481 protein At3g47200-like [Glycine... [more]
gi|356515284|ref|XP_003526331.1|5.129440e-13452.05PREDICTED: putative UPF0481 protein At3g02645-like... [more]
gi|356515264|ref|XP_003526321.1|1.882640e-13352.37PREDICTED: UPF0481 protein At3g47200-like [Glycine... [more]
gi|502134080|ref|XP_004501993.1|1.400490e-10442.96PREDICTED: UPF0481 protein At3g47200-like [Cicer a... [more]
gi|356577420|ref|XP_003556824.1|9.526490e-10344.57PREDICTED: UPF0481 protein At3g47200-like [Glycine... [more]
gi|255548970|ref|XP_002515541.1|5.306770e-10241.79conserved hypothetical protein [Ricinus communis] ... [more]
gi|356515272|ref|XP_003526325.1|7.528430e-10051.52PREDICTED: UPF0481 protein At3g47200-like [Glycine... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 80..94
score: NAcoord: 392..412
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0080.1 ID=Medtr0024s0080.1|Name=Medtr0024s0080.1|organism=Medicago truncatula|type=mRNA|length=1239bp
ATGTCATTGTCCAGCTTGGTTGATGATATGAATGTGATGCTCCACACAGC
AGATGCACCTTCAACCGATAATCGTTGCATCTACAAGGTCCCCTCTGTTA
TTCGCAAACACAATGAAGACGCATACACCCCTAATTTCGTTTCCATTGGC
CCCTTTCACCACGGTCACCCCCAGCTCAAAAACATGGAACGTCACAAACT
CATTTACTTCAAAGATTTTCTCCAACGAACCAATGCATCTTTAAGCATCT
TGATCAGCGACATATATTCTATCTTATCTGATTTCAAATGTTGTTATTCG
GAAACCCTATCATTTCCTCAGGATGAAGAACTTGTTAAGTTAATCTTAAT
CGATTCCGGTTTTATAATTCAACTTTTTTGGAAATATTTTAAGAAAGATT
TCCTAGAACCTTGGTTAGATGCTGGTATAAGATCAGATTTATTGTTACTT
GAAAATCAGCTTCCCTTTTTCGTTATTGAAAAAATTTACGGTCTTTCGTG
GAGTTCTACAAATGGTTCTTTTCTTGAACTCACTATTAATTATTTTCAAT
ATTTCAATCAATCAAAATTGGTTTTTGATAATAATAGTCAGTGCATAAGG
CACTTCACTGATCTGATTAGGATATTTCATTTGCAACATCCTATTGAAAG
TCAGCCAAGTAGAGACAAGATCGACGAACAGATAATACATCTACCGAGTG
CAACTCAGTTGTTAGAAGCTGGAGTTAGGTTTCAAGTGAAGCCTAAAAGT
GAGTGTTTACTTGACTTGGGGTTTTCGGAAGGAGTGCTTGAAATTCCTCG
ATTAGAAGTTGAGGATGGGACCGAAATTTTGTTTCGGAATATGGTTGCTT
TGGAGCAGTGTCATTACCCTTATGAGTCATATATTACTGATTATGTTGTT
GTTTTGGATTTCCTTATAAATACTGGTAAGGATGCGGATATACTTGTTCG
GAAAGAAATACTGACTAATTTGCTTGGAGACAGTGATTCTGTGGCTAACT
TGTTTAATCGTCTTTGCAAAAATGTTATACATCATAATATCAGTTCTCAT
TTCTCTATTCTTTGCAAAAACTTAAATGCATTTTGTAGTAATCCTTGGAA
TAGGTTGAAGGCTTCTCTCAGGCGTGATTATGGCAAAACTCCTTGGCAAA
CTGCTGCTTCCGTTGCTGGAATTTTACTACTTGTTCTCACTTTGCTTCAA
TCAGTTTGTTCTGTCTTGCAAGTAGTACAAGCCTCCTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated