Overview
NameMedtr0024s0070.1
Unique NameMedtr0024s0070.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1197
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0008283 cell proliferation
biological_process GO:0006952 defense response
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00415.1324107-24301319-3831-5147.12.7e-16296.23e-90
PF13540.124059-24145303-3311-2933.04.1e-12197.94.9e-60

Homology
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|502180620|ref|XP_004516679.1| (PREDICTED: ultraviolet-B receptor UVR8-like [Cicer arietinum])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|255551398|ref|XP_002516745.1| (Ran GTPase binding protein, putative [Ricinus communis] >gi|223544118|gb|EEF45643.1| Ran GTPase binding protein, putative [Ricinus communis])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|224127630|ref|XP_002329325.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|595935453|ref|XP_007215499.1| (hypothetical protein PRUPE_ppa006886mg [Prunus persica] >gi|462411649|gb|EMJ16698.1| hypothetical protein PRUPE_ppa006886mg [Prunus persica])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|356573964|ref|XP_003555124.1| (PREDICTED: E3 ubiquitin-protein ligase HERC2-like [Glycine max])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|595935460|ref|XP_007215500.1| (hypothetical protein PRUPE_ppa006886mg [Prunus persica] >gi|462411650|gb|EMJ16699.1| hypothetical protein PRUPE_ppa006886mg [Prunus persica])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|590652998|ref|XP_007033301.1| (Regulator of chromosome condensation (RCC1) family protein [Theobroma cacao] >gi|508712330|gb|EOY04227.1| Regulator of chromosome condensation (RCC1) family protein [Theobroma cacao])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|470136737|ref|XP_004304140.1| (PREDICTED: probable E3 ubiquitin-protein ligase HERC4-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|449447492|ref|XP_004141502.1| (PREDICTED: LOW QUALITY PROTEIN: probable E3 ubiquitin-protein ligase HERC1-like [Cucumis sativus])
BLAST of Medtr0024s0070.1 vs. NCBI nr
Match: gi|449481449|ref|XP_004156186.1| (PREDICTED: LOW QUALITY PROTEIN: probable E3 ubiquitin-protein ligase HERC1-like [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0024s0070.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180620|ref|XP_004516679.1|0.000000e+090.79PREDICTED: ultraviolet-B receptor UVR8-like [Cicer... [more]
gi|255551398|ref|XP_002516745.1|0.000000e+087.44Ran GTPase binding protein, putative [Ricinus comm... [more]
gi|224127630|ref|XP_002329325.1|7.089490e-1587.44predicted protein [Populus trichocarpa][more]
gi|595935453|ref|XP_007215499.1|0.000000e+086.29hypothetical protein PRUPE_ppa006886mg [Prunus per... [more]
gi|356573964|ref|XP_003555124.1|0.000000e+087.31PREDICTED: E3 ubiquitin-protein ligase HERC2-like ... [more]
gi|595935460|ref|XP_007215500.1|0.000000e+086.04hypothetical protein PRUPE_ppa006886mg [Prunus per... [more]
gi|590652998|ref|XP_007033301.1|0.000000e+086.41Regulator of chromosome condensation (RCC1) family... [more]
gi|470136737|ref|XP_004304140.1|0.000000e+086.26PREDICTED: probable E3 ubiquitin-protein ligase HE... [more]
gi|449447492|ref|XP_004141502.1|0.000000e+084.02PREDICTED: LOW QUALITY PROTEIN: probable E3 ubiqui... [more]
gi|449481449|ref|XP_004156186.1|0.000000e+084.02PREDICTED: LOW QUALITY PROTEIN: probable E3 ubiqui... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000408Regulator of chromosome condensation, RCC1PRINTSPR00633RCCNDNSATIONcoord: 4..20
score: 1.4e-18coord: 38..51
score: 1.4e-18coord: 57..73
score: 1.4e-18coord: 255..273
score: 1.4e-18coord: 315..336
score: 1.4
IPR000408Regulator of chromosome condensation, RCC1PROSITEPS00626RCC1_2coord: 373..383
score
IPR000408Regulator of chromosome condensation, RCC1PROFILEPS50012RCC1_3coord: 3..54
score: 12.735coord: 55..107
score: 14.805coord: 108..167
score: 14.745coord: 168..213
score: 9.519coord: 214..265
score: 17.881coord: 266..319
score: 19.830coord: 320..386
score: 12
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein IIGENE3D2.130.10.30no descriptioncoord: 149..385
score: 9.9
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein IISUPERFAMILY50985RCC1/BLIP-IIcoord: 3..390
score: 5

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0024s0070.1 ID=Medtr0024s0070.1|Name=Medtr0024s0070.1|organism=Medicago truncatula|type=mRNA|length=1197bp
ATGGCTTCCAACATCATTGCCTGGGGTTCAGGTGAAGATGGTCAATTAGG
AATTGGTACAAACGAAGATAAGGAATGGGTTTGTTCTGTTAAAGCTCTTC
CTTCTCAACATGTTCGTTCTGTTGTTGCTGGTAGTAGAAATTCACTCGCC
ATTTTGAATGATGGCAAGTTGTTTACATGGGGTTGGAATCAAAGGGGAAC
TCTTGGACACCCAGCTGAGACCAAGACTGAAAACATTCCCAGCCAAGTCA
AAGCACTTTCCCATGCTCACATTGTTCAGGCGGCTATTGGTGGTTGGCAC
TGTTTGGCTGTTGATGATCACGGAAAAGCTTATGCTTGGGGTGGAAATGA
ATATGGTCAGTGTGGTGAAGAACCTGAGCGCAAGGATGACAATGGTAGAC
CTTTGAGGAGAGATATTGTGATCCCTCAGCCTTGTGCTCCTAAGCTTTCT
GTTCGACAGGTTGCTGCTGGAGGAACTCACTCAGTGGTACTTACACGTGA
AGGGCATGTTTGGACATGGGGTCAGCCATGGCCTCCTGGTGACATTAAAC
AGATTTCAGTCCCGGTTCGGGTGCAAGGTCTTGATAATATAAAGCTTATA
GCAGTAGGTGCATTTCATAATTTGGCACTCCAAGAAGATGGAACTCTGTG
GGCTTGGGGTAATAATGAATATGGACAACTTGGAACTGGAGATACGCAAC
CAAGGTCACAACCTGTTCCTGTGCAAGGACTCTCTGGACTTACCGTGGTA
GATATTGCAGCTGGTGGATGGCACTCTACTGCATTGACAGATGACGGAGA
GGTATATGGCTGGGGAAGGGGAGAACATGGTAGGCTGGGATTTGGTGATA
GTGATAAGAGCAGTAAAATGTTACCTCAGAGGGTTCAACTTTTAGCCGGC
GAAGATATTGTGCAGGTGTCTTGTGGAGGTACTCATTCTGTTGCATTAAC
CCGAGATGGGCGCATATTTTCTTTTGGTAGAGGTGATCATGGACGGCTTG
GATATGGGAGGAAAGTCACTACTGGTCAACCAATGGAGGTACCTATAGAC
ATCCCTCCTCCACAGAATCTCGGTGACGCTGACGGTGAAGCTGAGGGAAA
TTGGATAGCCAAACTCGTCGCTTGTGGTGGCCGTCATACTTTGGCAATAG
TAGAATGGAAAGATGATGAATCTAAAGCTGAATCTATTCATGATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000408Regulator of chromosome condensation, RCC1
IPR009091Regulator of chromosome condensation/beta-lactamase-inhibitor protein II
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0006952defense response
GO:0006950response to stress
GO:0008150biological_process
GO:0008283cell proliferation
GO:0044699single-organism process
GO:0050896response to stimulus