Overview
NameMedtr0019s0290.1
Unique NameMedtr0019s0290.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length483
Homology
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|289540893|gb|ADD09570.1| (unknown [Trifolium repens])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|502122347|ref|XP_004497701.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like, partial [Cicer arietinum])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|502137833|ref|XP_004503202.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [Cicer arietinum])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|470148424|ref|XP_004309765.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|470140450|ref|XP_004305953.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|470113674|ref|XP_004293046.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|242063606|ref|XP_002453092.1| (hypothetical protein SORBIDRAFT_04g038323 [Sorghum bicolor] >gi|241932923|gb|EES06068.1| hypothetical protein SORBIDRAFT_04g038323 [Sorghum bicolor])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|218201872|gb|EEC84299.1| (hypothetical protein OsI_30784 [Oryza sativa Indica Group])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|242032557|ref|XP_002463673.1| (hypothetical protein SORBIDRAFT_01g004013 [Sorghum bicolor] >gi|241917527|gb|EER90671.1| hypothetical protein SORBIDRAFT_01g004013 [Sorghum bicolor])
BLAST of Medtr0019s0290.1 vs. NCBI nr
Match: gi|356506571|ref|XP_003522053.1| (PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0290.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|289540893|gb|ADD09570.1|4.070850e-7476.32unknown [Trifolium repens][more]
gi|502122347|ref|XP_004497701.1|7.281100e-1433.63PREDICTED: protein FAR1-RELATED SEQUENCE 5-like, p... [more]
gi|502137833|ref|XP_004503202.1|8.339740e-1433.63PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [C... [more]
gi|470148424|ref|XP_004309765.1|6.145070e-1332.74PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [F... [more]
gi|470140450|ref|XP_004305953.1|1.738020e-1234.55PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [F... [more]
gi|470113674|ref|XP_004293046.1|3.816360e-1135.85PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [F... [more]
gi|242063606|ref|XP_002453092.1|3.848830e-1133.64hypothetical protein SORBIDRAFT_04g038323 [Sorghum... [more]
gi|218201872|gb|EEC84299.1|7.860800e-1133.33hypothetical protein OsI_30784 [Oryza sativa Indic... [more]
gi|242032557|ref|XP_002463673.1|1.005100e-1033.64hypothetical protein SORBIDRAFT_01g004013 [Sorghum... [more]
gi|356506571|ref|XP_003522053.1|2.035730e-1032.74PREDICTED: protein FAR1-RELATED SEQUENCE 5-like [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0290.1 ID=Medtr0019s0290.1|Name=Medtr0019s0290.1|organism=Medicago truncatula|type=mRNA|length=483bp
ATGCATATCAAAACCCCATCCCGTTACGTATCAGAGCGACCTAGACGACA
CAGTTTCAAGAAGGGAAGTTTGCTTAATCCTAACAACAGGCCAACATCAG
ACAGTCCACTGGTTATTGAGTTTGTGAAAGTGACAGAAAAACCTGAGGAA
AGGGTTGGTTGTAAAGCTGGAATATCTTTGAAGCTGGATGAAGTTTTGAA
TGTGTATAAGATTTATAGATGGGATGTGGCTCACTGTCATCCATTATATA
AACCAGAGCATTTGTGTTACCTTAGATCATTTCGAGAAGTAAATGAAGTT
CAAGGACAACTAGCTCTAATAAATTCTAAAGTTGGAATGTCGATGAGAAC
GTCTTATGAAGTTATTGGTCAAGGAGTTGGAGGTACGGAGAATCTTCCTT
TTCGATTTTCAGACTTAAAGAACTATCTAATGACAATTCGTCAAAAGGAG
ATGGTGGTTGGTGAAGCAACTGTAATTCAATAA
back to top