Overview
NameMedtr0019s0270.1
Unique NameMedtr0019s0270.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length504
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0005634 nucleus
molecular_function GO:0003677 DNA binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01429.14163649-16346446-10711-7537.67.3e-1438.46e-10

Homology
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|502118026|ref|XP_004496064.1| (PREDICTED: methyl-CpG-binding domain-containing protein 4-like [Cicer arietinum])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|358248398|ref|NP_001239875.1| (uncharacterized protein LOC100802350 [Glycine max] >gi|255641529|gb|ACU21038.1| unknown [Glycine max])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|356535711|ref|XP_003536387.1| (PREDICTED: methyl-CpG-binding domain-containing protein 4-like isoform X1 [Glycine max])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|388511439|gb|AFK43781.1| (unknown [Lotus japonicus])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|388503158|gb|AFK39645.1| (unknown [Lotus japonicus])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|255567630|ref|XP_002524794.1| (DNA binding protein, putative [Ricinus communis] >gi|223535978|gb|EEF37637.1| DNA binding protein, putative [Ricinus communis])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|470108793|ref|XP_004290693.1| (PREDICTED: methyl-CpG-binding domain-containing protein 4-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|224128656|ref|XP_002320386.1| (methyl-CpG-binding domain-containing family protein [Populus trichocarpa] >gi|118485542|gb|ABK94623.1| unknown [Populus trichocarpa] >gi|222861159|gb|EEE98701.1| methyl-CpG-binding domain-containing family protein [Populus trichocarpa])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|224117174|ref|XP_002331766.1| (methyl binding domain protein [Populus trichocarpa])
BLAST of Medtr0019s0270.1 vs. NCBI nr
Match: gi|565468056|ref|XP_006291908.1| (hypothetical protein CARUB_v10018085mg [Capsella rubella] >gi|482560615|gb|EOA24806.1| hypothetical protein CARUB_v10018085mg [Capsella rubella])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0270.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502118026|ref|XP_004496064.1|8.151470e-4977.45PREDICTED: methyl-CpG-binding domain-containing pr... [more]
gi|358248398|ref|NP_001239875.1|2.960820e-4772.22uncharacterized protein LOC100802350 [Glycine max]... [more]
gi|356535711|ref|XP_003536387.1|1.455560e-4672.22PREDICTED: methyl-CpG-binding domain-containing pr... [more]
gi|388511439|gb|AFK43781.1|2.274560e-4666.10unknown [Lotus japonicus][more]
gi|388503158|gb|AFK39645.1|7.599590e-4470.09unknown [Lotus japonicus][more]
gi|255567630|ref|XP_002524794.1|2.005200e-3760.19DNA binding protein, putative [Ricinus communis] >... [more]
gi|470108793|ref|XP_004290693.1|3.207700e-3658.33PREDICTED: methyl-CpG-binding domain-containing pr... [more]
gi|224128656|ref|XP_002320386.1|4.448470e-3556.60methyl-CpG-binding domain-containing family protei... [more]
gi|224117174|ref|XP_002331766.1|3.041810e-3455.96methyl binding domain protein [Populus trichocarpa... [more]
gi|565468056|ref|XP_006291908.1|8.828300e-3362.92hypothetical protein CARUB_v10018085mg [Capsella r... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001739Methyl-CpG DNA bindingGENE3D3.30.890.10no descriptioncoord: 19..126
score: 3
IPR001739Methyl-CpG DNA bindingSMARTSM00391no descriptioncoord: 38..111
score: 4
IPR001739Methyl-CpG DNA bindingPROFILEPS50982MBDcoord: 36..106
score: 13
IPR016177DNA-binding, integrase-typeSUPERFAMILY54171DNA-binding domaincoord: 14..111
score: 1.5
NoneNo IPR availableSEGsegsegcoord: 119..137
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0270.1 ID=Medtr0019s0270.1|Name=Medtr0019s0270.1|organism=Medicago truncatula|type=mRNA|length=504bp
ATGGCTAAATGCACATGCTGGTCACAAAATGATCTTAACGTGTGTGGTCT
TGTTAATTCAAAGGTATATGAACCTGCTGATATCGAATATGATTCTTCTC
GAAAATGGGTCATTTACAAGCCTAACATTCCAAAGACTCCACAAGGTTTC
AAGAGAATCATGGTGCTTAGAAAGGATTACTCTAAATTGGACTCTAACTA
CATCACACCTACAGGTAAAAATCAGAGAACCCGCAATGAGATAGCAATAT
ATCTTAAAGATCATCCACAACCAAGTGGTGTATCTGCTTCGGAATTTAAT
TTTTCATCCCCAAAGGTTATGCAAGACACTGTCCCAGAATTTATTGTGAA
ACAGAAGGATTCTGCGGAAAAAAAAAAGCTAAGAAAACTAAAGATGAAGT
TTGAGAAAAGTCATCACAAGGTTGCTGCATGCTTTTGTTGTGATATATTA
TTTCTAGATATAGTGTTAAGTAACGCCAATTCAGTGGTAGTGAAACAAAT
TTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001739Methyl-CpG DNA binding
IPR016177DNA-binding, integrase-type
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003677DNA binding
Vocabulary: Cellular Component
TermDefinition
GO:0005634nucleus