Overview
NameMedtr0019s0210.1
Unique NameMedtr0019s0210.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1665
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0007154 cell communication
biological_process GO:0009987 cellular process
biological_process GO:0051716 cellular response to stimulus
biological_process GO:0010019 chloroplast-nucleus signaling pathway
biological_process GO:0031930 mitochondria-nucleus signaling pathway
biological_process GO:0050789 regulation of biological process
biological_process GO:0050794 regulation of cellular process
biological_process GO:0050896 response to stimulus
biological_process GO:0007165 signal transduction
biological_process GO:0023052 signaling
biological_process GO:0044700 single organism signaling
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0004016 adenylate cyclase activity
molecular_function GO:0005488 binding
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009975 cyclase activity
molecular_function GO:0016829 lyase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016849 phosphorus-oxygen lyase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01535.15127034-12694599-1281-3019.92.3e-07331.32e-103
PF12854.2127052-12696993-1202-2927.29.2e-10480.14.7e-148
PF13041.1127151-12699960-1102-5031.46.1e-11518.58.5e-160
PF13812.1126719-126621204-2362-3410.40.00031217.62.2e-67

Homology
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502167318|ref|XP_004514106.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X1 [Cicer arietinum] >gi|502167322|ref|XP_004514107.1| PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X2 [Cicer arietinum] >gi|502167325|ref|XP_004514108.1| PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X3 [Cicer arietinum] >gi|502167330|ref|XP_004514109.1| PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X4 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502170281|ref|XP_004514796.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like isoform X1 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502183277|ref|XP_004517102.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g62910-like [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502178867|ref|XP_004516337.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X1 [Cicer arietinum] >gi|502178870|ref|XP_004516338.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X2 [Cicer arietinum] >gi|502178872|ref|XP_004516339.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X3 [Cicer arietinum] >gi|502178875|ref|XP_004516340.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X4 [Cicer arietinum] >gi|502178880|ref|XP_004516341.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X5 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502178913|ref|XP_004516347.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like isoform X1 [Cicer arietinum] >gi|502178918|ref|XP_004516348.1| PREDICTED: pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like isoform X2 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502182600|ref|XP_004516965.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X1 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502178943|ref|XP_004516350.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial-like isoform X1 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502081085|ref|XP_004486761.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X1 [Cicer arietinum] >gi|502081088|ref|XP_004486762.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X2 [Cicer arietinum] >gi|502081091|ref|XP_004486763.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X3 [Cicer arietinum] >gi|502081094|ref|XP_004486764.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X4 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502163324|ref|XP_004512803.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X1 [Cicer arietinum] >gi|502163327|ref|XP_004512804.1| PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like isoform X2 [Cicer arietinum])
BLAST of Medtr0019s0210.1 vs. NCBI nr
Match: gi|502163027|ref|XP_004512700.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0210.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502167318|ref|XP_004514106.1|0.000000e+064.75PREDICTED: putative pentatricopeptide repeat-conta... [more]
gi|502170281|ref|XP_004514796.1|0.000000e+065.47PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502183277|ref|XP_004517102.1|0.000000e+065.41PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502178867|ref|XP_004516337.1|0.000000e+065.12PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502178913|ref|XP_004516347.1|0.000000e+064.16PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502182600|ref|XP_004516965.1|0.000000e+065.04PREDICTED: putative pentatricopeptide repeat-conta... [more]
gi|502178943|ref|XP_004516350.1|0.000000e+064.86PREDICTED: putative pentatricopeptide repeat-conta... [more]
gi|502081085|ref|XP_004486761.1|0.000000e+063.67PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502163324|ref|XP_004512803.1|0.000000e+062.94PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|502163027|ref|XP_004512700.1|0.000000e+062.94PREDICTED: pentatricopeptide repeat-containing pro... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002885Pentatricopeptide repeatTIGRFAMsTIGR00756PPR: pentatricopeptide repeat domaincoord: 99..133
score: 1.3e-07coord: 134..168
score: 4.4e-07coord: 169..203
score: 0.0028coord: 204..238
score: 1.9e-08coord: 239..273
score: 4.6e-09coord: 274..308
score: 1.5e-08coord: 309..343
score: 0.0036coord: 344..378
score: 3.2e-12coord: 379..413
score: 3.8e-11coord: 414..448
score: 3.3e-10coord: 449..483
score: 4.2e-09coord: 484..518
score: 2.4e-11coord: 519..553
score: 0.0
IPR002885Pentatricopeptide repeatPROFILEPS51375PPRcoord: 97..131
score: 10.907coord: 60..96
score: 7.202coord: 132..166
score: 11.027coord: 167..197
score: 9.175coord: 202..236
score: 10.994coord: 237..271
score: 11.707coord: 272..306
score: 11.860coord: 307..341
score: 9.679coord: 342..376
score: 13.439coord: 377..411
score: 13.548coord: 412..446
score: 13.022coord: 447..481
score: 11.444coord: 482..516
score: 13.954coord: 517..551
score: 10
IPR011990Tetratricopeptide-like helicalGENE3D1.25.40.10no descriptioncoord: 355..475
score: 7.5
NoneNo IPR availableSEGsegsegcoord: 4..19
score
NoneNo IPR availableSUPERFAMILY48452TPR-likecoord: 377..475
score: 0.0
NoneNo IPR availableSUPERFAMILY81901HCP-likecoord: 40..194
score: 0.0

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0210.1 ID=Medtr0019s0210.1|Name=Medtr0019s0210.1|organism=Medicago truncatula|type=mRNA|length=1665bp
ATGTCTTGGTTGTTATTGTCATCCAGGTTTCGTTCTTCTTTTTCTTCTTC
TTCTTTTATTTTTCCCTTCTTAACAAGAAGACCATATTCTCACTCTACAT
TCATTCCCAATAATTTTGATGATGTTGATAATGCTGTTTCTTCATTCAAT
CACATGTTTCGTATGAATCCTTCTCCATCCATCATTCAATTTAACAAGAT
TTTAGGTTCCCTTGTTAAGTCTAACAACAATCATTACCCTACTGCTATTT
CCCTTTTTCATCAATTGGAATTTCATGGAATTACACCTGATATTGTTACT
TTCAATATTCTCATTAATTGTTACTGCCATCTTCGGGAAATGGATTTTTC
CTTTTCTATGTTGGCCAAGATTCTTAAAATGGGTTATCAGCCGGATACCA
TTACCTTTAATACTCTTATCAAAGGTTTGTGTGTTAATGGTAAGGTCAAG
GAGGCTCTGCACTTTCACGATCATGTGATTTCACTTGGATTCCACTTGGA
CCAAGTTAGCTATGGGACCTTGATCAATGGCTTGTGTAAAATAGGGGAAA
CAAGAGCAGCCTTGCAAATGTTGAGAAAGATTGAAGGGAAATTGGTCAAC
ACCAATGTGGTAATGTACAGCACAATAATCGATAGTTTGTGTAAAGATAA
ATTGGTGACCGAGGCATATGTGTTATATTCTGAAATGATTACAAAGAGAA
TTTCTCCCAATGTTGTCACTTTCAATTCTCTAATTTATGGATTTTGTATT
GTTGGTCAATTCAAAGATGCGTTTCGTTTGTTCCATGAAATAGTATTGAA
AAACATCAACCCAGATGTTTATACTTTTAATATAATGGTTGATGCTCTAT
GTAAGGAAGGAAAGATGAAAGAAGCTAAAAGTGTGATAGCTGTGATGATG
AAAGAATGTGTGATGCCCGATGTTGTTACCTACAATTCATTAATGGATGG
ATATTGCCTAGTTAATGAAGTCAATAAGGCCAAACATGTGCTAATCATTA
TTTCTAAAATAAGAGTGGCTCCTGATGCTCATAGCTATAGTATCATGATT
AATGGATTATGTAAGGTTAAAATGGTCGACGAAGCCTTGAGTCTCTTTTA
TGAAATGCGTTGCAGAGGAATTGCTCCTAATACGGTAACTTACAGTTCGC
TCATTGATGGTTTGTGCAAATCTGGGAGATACTCTTATGCTTGGGACCTT
GTTGATGAGATGCATGATCATGGCCATCCACCCAATATATTCACTTACAA
TTCCTTAATAGATGCTTTATGCAAAAACCATCAGATTGACAAGGCTATTG
CATTAGTTAAGAAAATCAAAGATCAAGGCATTCAACCAGATATGTGCACA
TACAATATACTTATTGATGGACTATGCAAAGGAGGACGACTTCATAATGC
ACGAGATGTTTTTCAAGATCTTTTGATCAAGGGTTATAGTCTAGATGTTC
AAACGTATAATATTATGATCAATGGACTTTGTAAAGTGGGTTTATTTGAT
GAAGCGGAGGTCTTGCTGTCAAAAATGGAAGACAATGGCATAATTCCTGA
TGCTGTAACTTATGAAACTATCATCCGGGCTTTCTTTCATAAAGATGAGA
ATGAAAAGGCGGAGAAACTTCTTCGTGAAATGATTGCTAGAGGTCTACTT
AAATGGAAACACTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002885Pentatricopeptide repeat
IPR011990Tetratricopeptide-like helical
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005488binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004016adenylate cyclase activity
GO:0009975cyclase activity
GO:0016829lyase activity
GO:0016849phosphorus-oxygen lyase activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0007165signal transduction
GO:0007154cell communication
GO:0008150biological_process
GO:0009987cellular process
GO:0010019chloroplast-nucleus signaling pathway
GO:0023052signaling
GO:0031930mitochondria-nucleus signaling pathway
GO:0044699single-organism process
GO:0044700single organism signaling
GO:0044763single-organism cellular process
GO:0050789regulation of biological process
GO:0050794regulation of cellular process
GO:0050896response to stimulus
GO:0051716cellular response to stimulus
GO:0065007biological regulation