Overview
NameMedtr0019s0190.1
Unique NameMedtr0019s0190.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length561
Homology
The following BLAST results are available for this feature:
BLAST of Medtr0019s0190.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 35..49
score: NAcoord: 163..174
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0190.1 ID=Medtr0019s0190.1|Name=Medtr0019s0190.1|organism=Medicago truncatula|type=mRNA|length=561bp
ATGGTGAAACAAGCAATGGGGAGGCATGGATTTGGTTGCATCCAAGAAAG
GAACTACGCTGGTAGACGACTCAAACTCACGGAATATGCTGCTCAGTCAG
CATCCAAAAGAGTTAAAGTACTCCTCGTTTCGAATTCGGTGAAAAAAGCA
ACTCTTCTCCATGCAAATTTCTCAATACCTGCTCTGATTGTTGCTTGGTC
TGCCCACATTATTTTCCAAAGGCAGATAGTCTGTTCTAAATGTCAACTTC
CTACAAATGAAGAGAGTAGTAAAAGGGAAGGAAAATATCCTAAACTTGTG
AACAAATCAATTCATACTACGAAAGCAGAGATTGAAATCATGATAAAAGT
ATGGTTACTCAAGCATATCGAAACCATAATACAACAACCAATTCCGTTTC
AAAATCTGAGGGCAATGACAACATACAATGTTATTGAAGATGAAAGCACC
ATGGGCACAATACCAATACAATATTACAAGAATGAAAACACACCCACACC
CCCTTTGCTTAACTCACCACCAAGGGTCAAATACCGAAAAAGAAGACTAC
GCGTTAACTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated