Overview
NameMedtr0019s0170.1
Unique NameMedtr0019s0170.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1146
Homology
BLAST of Medtr0019s0170.1 vs. NCBI nr
Match: gi|356495240|ref|XP_003516487.1| (PREDICTED: uncharacterized protein LOC100806744 [Glycine max])
BLAST of Medtr0019s0170.1 vs. NCBI nr
Match: gi|356504151|ref|XP_003520862.1| (PREDICTED: uncharacterized protein LOC100811416 [Glycine max])
BLAST of Medtr0019s0170.1 vs. NCBI nr
Match: gi|356503762|ref|XP_003520673.1| (PREDICTED: uncharacterized protein LOC100782572 [Glycine max])
BLAST of Medtr0019s0170.1 vs. NCBI nr
Match: gi|356495394|ref|XP_003516563.1| (PREDICTED: uncharacterized protein LOC100818308 [Glycine max])
BLAST of Medtr0019s0170.1 vs. NCBI nr
Match: gi|356551546|ref|XP_003544135.1| (PREDICTED: uncharacterized protein LOC100807235 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0170.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 5
Match NameE-valueIdentityDescription
gi|356495240|ref|XP_003516487.1|2.517300e-732.53PREDICTED: uncharacterized protein LOC100806744 [G... [more]
gi|356504151|ref|XP_003520862.1|4.133720e-631.33PREDICTED: uncharacterized protein LOC100811416 [G... [more]
gi|356503762|ref|XP_003520673.1|7.809960e-631.33PREDICTED: uncharacterized protein LOC100782572 [G... [more]
gi|356495394|ref|XP_003516563.1|8.796500e-628.83PREDICTED: uncharacterized protein LOC100818308 [G... [more]
gi|356551546|ref|XP_003544135.1|1.853090e-428.57PREDICTED: uncharacterized protein LOC100807235 [G... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 370..378
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0170.1 ID=Medtr0019s0170.1|Name=Medtr0019s0170.1|organism=Medicago truncatula|type=mRNA|length=1146bp
ATGTCGCAAAATGCAGTTTTTCTTGTAGCAAGAGCAAGTGGGGGAAAAAG
AGGAAGGTTCAAATGCAAGAATTGGAAGAAATGCGTGTTCAAGCGTATGA
ATCCTCTAAATTATACAAGGAGAAGCATTAGATCACAAGCATTGCAAAGC
AAAAATTTAAGCAACTTTGAGGAAATTGTGTCATGTTCGCTTAAGCGACC
AGAGATGGCACCGAAAAATCAATTACCCGCCAAACGAAAAACCACAGTTT
CATCCTTCGGTACCATTAACCGATCCATACCCTTACCTAGAAATCCTGAT
AGGACCCGGTTCACCTCGAACAAACACTATGATAGGTTCCTAAAGTTAAC
CAAGGGAACTTGGCATGACAAAGTGTTCAGAGTTAACCCTTTAGGACCTT
ATGCTAACCTCCTCCAGATGTTAACCGATAGGAAGTGGGACAAGCTCTTA
AGTCCACCCACATTAATCGACCCGGACATCGTGAAGGAATTCTATGCTAA
TGCCATGCCCGAGTGTGATAAAAGGGACATGGATGCCCAGTTCTCGTACA
CGACCTTTGTGAGGGGAAAGACCATTCTTTTTGACCGAGATATCATCAAT
GCCTACCTTGGTAACCCTCTCACTTTACCACCACCCGAGGACCCCACAGT
CCCTACTTTATGCGAGTATGGTCGAAAAGAGGAAGAGAAAGAGTGGGACT
ATGACGAGATAGTAAGGGACATCTTGTTGCCTGGAAAGCGGTATAACAAA
GGAAGATTGGATGATACAACCACGGCCAGTTACGGTGACATGACTTTTGA
AGCCGCTTTCGTTTTCAAATTCTTGGTGCACAATGTGTGGCCCAAGAGTC
ATGAGCAGAGAGCTCGGCAACAGGAGAAGAGGGACCTCCTCATGATGGAC
CAGCAAGCTGCTGTCTTCAGGAGTAAGCAGGGGATCTACCAGCATCTCTA
TGATGCTCACTTGGATCCGACTTATGCGATGTTGACTCCCGCCCATTATT
ACCAGTCTTGCATGTGGCCTGGGGACAGGCCAGTCTACTCTGAAGGGGAT
GGTGCATTCGGTGGTCCTGTCAACGACGAGGAGAGGACTGCTAGTGTTCA
TGGCGTGGATGACATGGAGGATGATGGGGATGATGCGGCGAACTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated