Overview
NameMedtr0019s0160.1
Unique NameMedtr0019s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length435
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0000003 reproduction
cellular_component GO:0005736 DNA-directed RNA polymerase I complex
cellular_component GO:0005665 DNA-directed RNA polymerase II, core complex
cellular_component GO:0016591 DNA-directed RNA polymerase II, holoenzyme
cellular_component GO:0005666 DNA-directed RNA polymerase III complex
cellular_component GO:0000428 DNA-directed RNA polymerase complex
cellular_component GO:0030880 RNA polymerase complex
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043232 intracellular non-membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0070013 intracellular organelle lumen
cellular_component GO:0044446 intracellular organelle part
cellular_component GO:0044424 intracellular part
cellular_component GO:0032991 macromolecular complex
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0031974 membrane-enclosed lumen
cellular_component GO:0043228 non-membrane-bounded organelle
cellular_component GO:0055029 nuclear DNA-directed RNA polymerase complex
cellular_component GO:0031981 nuclear lumen
cellular_component GO:0044428 nuclear part
cellular_component GO:0044452 nucleolar part
cellular_component GO:0005730 nucleolus
cellular_component GO:0005654 nucleoplasm
cellular_component GO:0044451 nucleoplasm part
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
cellular_component GO:0043233 organelle lumen
cellular_component GO:0044422 organelle part
cellular_component GO:0043234 protein complex
molecular_function GO:0003677 DNA binding
molecular_function GO:0003899 DNA-directed RNA polymerase activity
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01192.17103798-10396559-1142-5783.15.5e-2884.03.9e-24

Homology
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|224136924|ref|XP_002322450.1| (DNA-directed RNA polymerase II family protein [Populus trichocarpa] >gi|222869446|gb|EEF06577.1| DNA-directed RNA polymerase II family protein [Populus trichocarpa])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|470108469|ref|XP_004290539.1| (PREDICTED: DNA-directed RNA polymerases I, II, and III subunit RPABC2-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|595790371|ref|XP_007198938.1| (hypothetical protein PRUPE_ppa013019mg [Prunus persica] >gi|645245733|ref|XP_008229018.1| PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 6A-like [Prunus mume] >gi|462394233|gb|EMJ00137.1| hypothetical protein PRUPE_ppa013019mg [Prunus persica])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|356535896|ref|XP_003536478.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 6A-like [Glycine max])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|297835766|ref|XP_002885765.1| (hypothetical protein ARALYDRAFT_899271 [Arabidopsis lyrata subsp. lyrata] >gi|297331605|gb|EFH62024.1| hypothetical protein ARALYDRAFT_899271 [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|351724737|ref|NP_001236044.1| (uncharacterized protein LOC100305739 [Glycine max] >gi|255626491|gb|ACU13590.1| unknown [Glycine max])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|502108993|ref|XP_004493541.1| (PREDICTED: DNA-directed RNA polymerases I, II, and III subunit RPABC2-like [Cicer arietinum])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|297792515|ref|XP_002864142.1| (hypothetical protein ARALYDRAFT_495261 [Arabidopsis lyrata subsp. lyrata] >gi|297309977|gb|EFH40401.1| hypothetical protein ARALYDRAFT_495261 [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|15242235|ref|NP_200007.1| (RNA polymerase Rpb6 [Arabidopsis thaliana] >gi|75262545|sp|Q9FJ98.1|RPD6A_ARATH RecName: Full=DNA-directed RNA polymerases II, IV and V subunit 6A; AltName: Full=RNA polymerase Rpb6 [Arabidopsis thaliana] >gi|13878077|gb|AAK44116.1|AF370301_1 putative DNA-directed RNA polymerase II subunit [Arabidopsis thaliana] >gi|10177729|dbj|BAB11042.1| DNA-directed RNA polymerase II subunit-like protein [Arabidopsis thaliana] >gi|17104747|gb|AAL34262.1| putative DNA-directed RNA polymerase II subunit [Arabidopsis thaliana] >gi|21595784|gb|AAM66131.1| DNA-directed RNA polymerase II subunit-like protein [Arabidopsis thaliana] >gi|332008765|gb|AED96148.1| RNA polymerase Rpb6 [Arabidopsis thaliana])
BLAST of Medtr0019s0160.1 vs. NCBI nr
Match: gi|565435403|ref|XP_006281281.1| (hypothetical protein CARUB_v10027329mg [Capsella rubella] >gi|482549985|gb|EOA14179.1| hypothetical protein CARUB_v10027329mg [Capsella rubella])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|224136924|ref|XP_002322450.1|7.444440e-8185.42DNA-directed RNA polymerase II family protein [Pop... [more]
gi|470108469|ref|XP_004290539.1|1.995470e-7381.25PREDICTED: DNA-directed RNA polymerases I, II, and... [more]
gi|595790371|ref|XP_007198938.1|3.759320e-7179.17hypothetical protein PRUPE_ppa013019mg [Prunus per... [more]
gi|356535896|ref|XP_003536478.1|7.080220e-7186.81PREDICTED: DNA-directed RNA polymerases II, IV and... [more]
gi|297835766|ref|XP_002885765.1|4.578010e-6980.69hypothetical protein ARALYDRAFT_899271 [Arabidopsi... [more]
gi|351724737|ref|NP_001236044.1|5.112920e-6984.72uncharacterized protein LOC100305739 [Glycine max]... [more]
gi|502108993|ref|XP_004493541.1|9.590410e-6985.52PREDICTED: DNA-directed RNA polymerases I, II, and... [more]
gi|297792515|ref|XP_002864142.1|1.316160e-6880.00hypothetical protein ARALYDRAFT_495261 [Arabidopsi... [more]
gi|15242235|ref|NP_200007.1|2.056610e-6880.00RNA polymerase Rpb6 [Arabidopsis thaliana] >gi|752... [more]
gi|565435403|ref|XP_006281281.1|4.860010e-6880.00hypothetical protein CARUB_v10027329mg [Capsella r... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006110RNA polymerase, subunit omega/K/RPABC2SUPERFAMILY63562RPB6/omega subunit-likecoord: 1..135
score: 9.6
IPR012293RNA polymerase subunit, RPB6/omegaGENE3D3.90.940.10no descriptioncoord: 24..134
score: 1.2
IPR020708DNA-directed RNA polymerase, 14-18kDa subunit, conserved sitePROSITEPS01111RNA_POL_K_14KDcoord: 66..80
score
NoneNo IPR availableSEGsegsegcoord: 12..61
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0160.1 ID=Medtr0019s0160.1|Name=Medtr0019s0160.1|organism=Medicago truncatula|type=mRNA|length=435bp
ATGGCCGACGATGACTACAATGACTTGGACATCGGATACGAAGATGAGCC
ACCAGAGCCTGGGATTGAAGAAGGTGCAGAGGTGGATGCAGATGACAACG
ACAACAATGATGAGATGGCTGGAGAGCCTATTGAAACCGAGGAAAAGGAA
CAAGAAGAGCCAACAGAAAGGCCTCGAAAGACATCGAAATATATGACCAA
GTATGAGCGTGCACGGATTTTGGGTACCCGTGCTCTTCAAATCAGTATGA
ATGCACCTGTCATGGTTGAGTTGGAAGGGGAGACTGACCCGCTTGAGATT
GCCATGAAAGAGCTTCGAGAGAAAAAGATACCCTTTACCATCCGTCGTTA
TTTGCCTGATGGAAGCTATGAAGACTGGGGAGTTGATGAATTGATTGTGG
AAGACTCATGGAAGAGGCAAGTTGGTGGTGATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006110RNA polymerase, subunit omega/K/RPABC2
IPR012293RNA polymerase subunit, RPB6/omega
IPR020708DNA-directed RNA polymerase, 14-18kDa subunit, conserved site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003677DNA binding
GO:0003899DNA-directed RNA polymerase activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0030880RNA polymerase complex
GO:0005622intracellular
GO:0005575cellular_component
GO:0000428DNA-directed RNA polymerase complex
GO:0005623cell
GO:0005634nucleus
GO:0005654nucleoplasm
GO:0005665DNA-directed RNA polymerase II, core complex
GO:0005666DNA-directed RNA polymerase III complex
GO:0005730nucleolus
GO:0005736DNA-directed RNA polymerase I complex
GO:0043231intracellular membrane-bounded organelle
GO:0016591DNA-directed RNA polymerase II, holoenzyme
GO:0031974membrane-enclosed lumen
GO:0031981nuclear lumen
GO:0032991macromolecular complex
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043228non-membrane-bounded organelle
GO:0043229intracellular organelle
GO:0043232intracellular non-membrane-bounded organelle
GO:0043233organelle lumen
GO:0043234protein complex
GO:0044422organelle part
GO:0044424intracellular part
GO:0044428nuclear part
GO:0044446intracellular organelle part
GO:0044451nucleoplasm part
GO:0044452nucleolar part
GO:0044464cell part
GO:0055029nuclear DNA-directed RNA polymerase complex
GO:0070013intracellular organelle lumen
Vocabulary: Biological Process
TermDefinition
GO:0000003reproduction
GO:0008150biological_process
GO:0032502developmental process