Overview
NameMedtr0019s0150.1
Unique NameMedtr0019s0150.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1965
Homology
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502146303|ref|XP_004506394.1| (PREDICTED: uncharacterized protein LOC101493015 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502176840|ref|XP_004515950.1| (PREDICTED: uncharacterized protein LOC101505536 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502166827|ref|XP_004513990.1| (PREDICTED: serine/arginine repetitive matrix protein 1-like [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502096837|ref|XP_004490842.1| (PREDICTED: uncharacterized protein LOC101508725 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502093982|ref|XP_004490110.1| (PREDICTED: uncharacterized protein LOC101513436 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502121359|ref|XP_004497285.1| (PREDICTED: histone-lysine N-methyltransferase MLL2-like [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502094981|ref|XP_004490343.1| (PREDICTED: uncharacterized protein LOC101488484 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502129824|ref|XP_004500437.1| (PREDICTED: uncharacterized protein LOC101500968 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502147842|ref|XP_004506937.1| (PREDICTED: uncharacterized protein LOC101490320 [Cicer arietinum])
BLAST of Medtr0019s0150.1 vs. NCBI nr
Match: gi|502176885|ref|XP_004515961.1| (PREDICTED: serine/arginine repetitive matrix protein 1-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0150.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502146303|ref|XP_004506394.1|1.172990e-5137.94PREDICTED: uncharacterized protein LOC101493015 [C... [more]
gi|502176840|ref|XP_004515950.1|4.318500e-4838.81PREDICTED: uncharacterized protein LOC101505536 [C... [more]
gi|502166827|ref|XP_004513990.1|3.218320e-4738.31PREDICTED: serine/arginine repetitive matrix prote... [more]
gi|502096837|ref|XP_004490842.1|5.602520e-4735.56PREDICTED: uncharacterized protein LOC101508725 [C... [more]
gi|502093982|ref|XP_004490110.1|8.734990e-4736.82PREDICTED: uncharacterized protein LOC101513436 [C... [more]
gi|502121359|ref|XP_004497285.1|5.140420e-4437.74PREDICTED: histone-lysine N-methyltransferase MLL2... [more]
gi|502094981|ref|XP_004490343.1|2.656390e-4336.57PREDICTED: uncharacterized protein LOC101488484 [C... [more]
gi|502129824|ref|XP_004500437.1|6.605860e-4238.50PREDICTED: uncharacterized protein LOC101500968 [C... [more]
gi|502147842|ref|XP_004506937.1|1.002290e-4138.63PREDICTED: uncharacterized protein LOC101490320 [C... [more]
gi|502176885|ref|XP_004515961.1|9.183170e-4138.82PREDICTED: serine/arginine repetitive matrix prote... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 12..40
score: NAcoord: 191..206
score: NAcoord: 582..590
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0150.1 ID=Medtr0019s0150.1|Name=Medtr0019s0150.1|organism=Medicago truncatula|type=mRNA|length=1965bp
ATGGCTAGAACAAAAGGGAATCACACTGATTTCTCCCTTTCTCCATCACC
CTCTCCTGAACGCTCTCCATCTCCACCACCTCCTCCGTCGCCGCGTAACC
CAAACTCCGATCCTTTCTCTTGCTCACCTCCAAAAAGTCAAACCAACTCT
GCTCCTCTCAAAACCTACTCTCGAATCGTTAGACCTAGAATGGCAAAATC
ATCTGAAACCCTTAAGAAACCCGTTCGTAAATCCACAAGACTTTCAGCAA
AAAGGAAAAGAGGTGACGTTATGTTCGTCGATTTGGATTCAGACGAGGAT
CGTCCCCTCAAAAATCTCAAGAAAAGTCCTACTGATTCCGAAAAGAATGC
TGAAAGGATTGAAAAGATTAAGAAAGATTTCAAAGATGCTGTTCAGAAAA
GGAAATTGCTAAAGGAATGCTCTAGCCCTCAATCCAAGAACAAGAAATCG
CTAAATGAAGGCTCTGCTTCTGAAATCAAGCACATGCGCATCCCCTTGCA
TGATCCCTCTCTGGATCGCAATTTCAAAAAATGGGTCGCAAGACCAATTG
GTGTGGGAAGAGTTTACAACTTTGAGAAGCTACTAAAAGAAGGTGTTGAA
CTTCTCAAGTTTGTCAAACCACTAGGTTGGACGAATTTCTTTCAGATCAA
AGAAACCCATTATCCAGAAGTGGTAAGAAATTTCTACTTCATGGCTGAAA
CTTTTCCAAAGGAAGATTTGATTGTCTCAAAAATTCAAGACAAAGTGATT
AAGTTATCTGCTGAAAGACTGGCTGTGATTCTGGACATTCCTCAGAAAGG
GCCGAAATGCTATGGAAGAACAGGATATGCAAATGCTGTGGTATCACGTT
TTGACATCATTCGAGAAATGTTTGTTAAGTATGAATCTGATGATGATCTG
ATTTCTGCAAATCTCAAAAAGGAATACAAACTTCTCCATAACATGTGTCA
ATTTTCTATCACCCCTCGAAAAGGAAGCAAACACAAGGTATCTGAAACTG
ATATTCTTGTTATGTATCACATGTTTCATAGTATTGATATCAATCTGCCT
GTCATAATCATTCGTCACATGATTCATGCCACCACTCTTAAGAAAACTAA
ATCTTGTGTCCCCTATGGAATGGTGCTTACTCGTGTTTTCAAGAATTTCA
ACATCAACCTTGACAAAGAGAAATTTGATACTGTCTGTTCAGAATTCTTG
CCCAAAAACATTGCTCATATGAAGAAAACACCCCCAATCGAGATTCCTCA
ACCGAGCAATACTCCTGATGAAGCTGAAACATCTATGAAAGGCAACAGGG
TAGACAAAGGAAAAGCTCCAATGGATGAGCTTTTGGATGCCATCTTGGAA
GAAACTTGTGAAGGAAATCCCATACCTAGCACTGTGATGCCTACCACTCA
AGTCTCTGAGAAGTTTAATCAAGCTTCAAACTCTGTCCTTGACTTAAACT
CTCCTTTTTTATCTCACATTCCAGGAAACACTTGGTTCGAACAAGCTGAG
AAAGCTTTCCCTTCTGCTGCTCATGGTGAACCCACTGTCGTATCTCCTCT
TTTCAGCCATCAACACGGTAGCTCTCCTTCTATTTTCGGTTCAAGTTTCT
TAGAAACTCTGCTCAGAACATCAAGCGGTTCAGGATCCTTCTCTGCCCCT
GTCAAATCTTACTTTGGTAACATGTTTTCTGATCAATCACTTCCTTCCCT
CCCATCTCACTTTGGAACCTTTGAAAGCTCTGGCCAATATGGACCACCAC
CAGCTCCACCCAACACTCCTGACGCTTCAGCTGGCTCTCGCAATGTGCCG
CCACCACCCCATCTGACAATGGCTGACCTCACTGCTGCTCTTCGTCCCAT
CCTTGAGAAACTTGATCTTGTCTACAACCTGCAATCCTTCATGGTTCTTG
ATTGGACTTTCATACACGCTTCAAAATCATTCAACAATAACCAGAATCAC
ATTCAAAATCCATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated