Overview
NameMedtr0019s0120.2
Unique NameMedtr0019s0120.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1605
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03141.1170766-69504114-5341-417611.61.1e-187612.25e-184
PF08241.770412-70131232-3252-9427.25.4e-1028.21.7e-06

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0120.2 ID=Medtr0019s0120.2|Name=Medtr0019s0120.2|organism=Medicago truncatula|type=mRNA|length=1605bp
ATGGCAAATGGTACCTCAACTTCACCAAAACCCTTCAAACCCTCAAAATA
CAATTCCTTTTTCAACTGCAAAAAAACAAATCTTTACTCTTTCATAGCTC
TACTTTGTATCATTTCATACTTTTTAGGCTCATACCAAAACAACACTTCC
ACATCAACTAGCAAAAATATCCAAAACAAGAAAGTCACACCAAAATGTCT
CCAAAAAAATCCAACAAACACAAAAACAAAAACAAAAACAACCAACTTAG
ATTTCTTCTCACATCACAACCTAACAAATCCAACAACCACATCCACAACA
AAATCCTCTCAATACCCACCATGCACCCCCTCTTTAACTGACTACACCCC
CTGTGAAGACCACACGCGCTCCTTAAAATACACGCGCGACAAAATGATAT
ATCGTGAACGACACTGTCCTAAGAAACATGAAATCTTAAAGTGTCGTGTT
CCAGCACCAAATGGTTACAAAAATCCTTTCCCATGGCCCACAAGTAGAGA
CATGGCTTGGTATGCAAATGTACCTTACCGTCATTTAACGGTGGAAAAAG
CTGGTCAAAATTGGATCCGTTTTGACGGTGATAAGTTCCGTTTTCCTGGT
GGTGGTACTATGTTTCCTAATGGTGCTGATAAGTATATTGATGATATTGG
GAAGTTGATTGATCTTGAAGATGGTTCTGTTAGAACTGCTGTTGATACTG
GTTGTGGGGTTGCTAGTTGGGGAGCCTATCTACTATCACGTGACATATTA
ACAGTGTCAATTGCACCAAGGGATACTCATGAAGCACAAGTTCAATTTGC
TCTTGAAAGAGGTGTTCCTGCAGTTATTGGTGTTTTTGCTTCAAAGAGAT
TACCTTTCCCTTCAAGAGCCTTTGACATGGCACATTGTTCTCGTTGTCTT
ATTCCATGGCCTGAATATGATGGACTTTATCTAAATGAAGTTGATAGAAT
TCTACGTCCTGGTGGGTATTGGATTCTATCTGGTCCACCAATTCACTGGA
AGAGATATTGGAAAGGATGGGAAAGAACAAAAGAAGACTTGAATGAAGAG
CAAACCAAAATTGAGAATGTAGCTAAAAGCCTTTGTTGGAATAAAATAGT
GGAGAAAGGTGATATTGCAATTTGGCAGAAACCAAAAAATCATTTAGATT
GCAAATTCACTCAAAATAGGCCTTTTTGCCAAGAGCAAAATAATCCTGAC
AAAGCATGGTACACAAACATGCAAACATGTTTAAATCCACTCCCTAAAGT
GTCCAACAAAGAAGAAATTTCAGGTGGGGAATTAAATAATTGGCCTCAAA
GACTAAAATCAACCCCACCAAGGATTTCAAAGGGGACCATTAAAGGTGTC
ACACCCCAAACATTCTCAAAAGACAATCAACTATGGAACAAAAGAGTATC
ATATTACAAAAAAGTTAACAATCAACTTGAAAAAGCTGGTAGATACAGGA
ACCTATTAGACATGAATGCTTATTTGGGTGGATTTGCAGCTTCACTTGTT
AAATATCCTATTTGGGTTATGAATGTTGTTCCTATTCAAGCTAAAGTTGA
TACACTTGGAGCAATATATGAAAGAGGGTTGATTGGAATGTATCATAATT
GGTGA
back to top