Overview
NameMedtr0019s0120.1
Unique NameMedtr0019s0120.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1911
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03141.1170766-69237114-6231-506766.51.3e-234767.05.9e-231
PF08241.770412-70131232-3252-9426.87.1e-1040.13.4e-10

Homology
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|502175398|ref|XP_004515722.1| (PREDICTED: probable methyltransferase PMT16-like [Cicer arietinum])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|356529267|ref|XP_003533217.1| (PREDICTED: probable methyltransferase PMT16-like [Glycine max])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|356559857|ref|XP_003548213.1| (PREDICTED: probable methyltransferase PMT16-like [Glycine max])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|502119373|ref|XP_004496597.1| (PREDICTED: probable methyltransferase PMT16-like [Cicer arietinum])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|470147238|ref|XP_004309222.1| (PREDICTED: probable methyltransferase PMT16-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|596044864|ref|XP_007220207.1| (hypothetical protein PRUPE_ppa002720mg [Prunus persica] >gi|462416669|gb|EMJ21406.1| hypothetical protein PRUPE_ppa002720mg [Prunus persica])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|255539529|ref|XP_002510829.1| (ATP binding protein, putative [Ricinus communis] >gi|223549944|gb|EEF51431.1| ATP binding protein, putative [Ricinus communis])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|460377167|ref|XP_004234366.1| (PREDICTED: probable methyltransferase PMT15-like [Solanum lycopersicum])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|356574475|ref|XP_003555372.1| (PREDICTED: probable methyltransferase PMT16-like [Glycine max])
BLAST of Medtr0019s0120.1 vs. NCBI nr
Match: gi|224122430|ref|XP_002318832.1| (predicted protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0120.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502175398|ref|XP_004515722.1|0.000000e+085.87PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|356529267|ref|XP_003533217.1|0.000000e+077.97PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|356559857|ref|XP_003548213.1|0.000000e+076.48PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|502119373|ref|XP_004496597.1|0.000000e+072.79PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|470147238|ref|XP_004309222.1|0.000000e+068.77PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|596044864|ref|XP_007220207.1|0.000000e+069.15hypothetical protein PRUPE_ppa002720mg [Prunus per... [more]
gi|255539529|ref|XP_002510829.1|0.000000e+068.35ATP binding protein, putative [Ricinus communis] >... [more]
gi|460377167|ref|XP_004234366.1|0.000000e+067.33PREDICTED: probable methyltransferase PMT15-like [... [more]
gi|356574475|ref|XP_003555372.1|0.000000e+069.69PREDICTED: probable methyltransferase PMT16-like [... [more]
gi|224122430|ref|XP_002318832.1|0.000000e+074.11predicted protein [Populus trichocarpa][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.40.50.150no descriptioncoord: 207..347
score: 7e-13coord: 462..584
score: 6.9
NoneNo IPR availableSEGsegsegcoord: 69..82
score: NAcoord: 95..103
score
NoneNo IPR availableSUPERFAMILY53335S-adenosyl-L-methionine-dependent methyltransferasescoord: 136..355
score: 2.3e-31coord: 465..588
score: 2.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0120.1 ID=Medtr0019s0120.1|Name=Medtr0019s0120.1|organism=Medicago truncatula|type=mRNA|length=1911bp
ATGGCAAATGGTACCTCAACTTCACCAAAACCCTTCAAACCCTCAAAATA
CAATTCCTTTTTCAACTGCAAAAAAACAAATCTTTACTCTTTCATAGCTC
TACTTTGTATCATTTCATACTTTTTAGGCTCATACCAAAACAACACTTCC
ACATCAACTAGCAAAAATATCCAAAACAAGAAAGTCACACCAAAATGTCT
CCAAAAAAATCCAACAAACACAAAAACAAAAACAAAAACAACCAACTTAG
ATTTCTTCTCACATCACAACCTAACAAATCCAACAACCACATCCACAACA
AAATCCTCTCAATACCCACCATGCACCCCCTCTTTAACTGACTACACCCC
CTGTGAAGACCACACGCGCTCCTTAAAATACACGCGCGACAAAATGATAT
ATCGTGAACGACACTGTCCTAAGAAACATGAAATCTTAAAGTGTCGTGTT
CCAGCACCAAATGGTTACAAAAATCCTTTCCCATGGCCCACAAGTAGAGA
CATGGCTTGGTATGCAAATGTACCTTACCGTCATTTAACGGTGGAAAAAG
CTGGTCAAAATTGGATCCGTTTTGACGGTGATAAGTTCCGTTTTCCTGGT
GGTGGTACTATGTTTCCTAATGGTGCTGATAAGTATATTGATGATATTGG
GAAGTTGATTGATCTTGAAGATGGTTCTGTTAGAACTGCTGTTGATACTG
GTTGTGGGGTTGCTAGTTGGGGAGCCTATCTACTATCACGTGACATATTA
ACAGTGTCAATTGCACCAAGGGATACTCATGAAGCACAAGTTCAATTTGC
TCTTGAAAGAGGTGTTCCTGCAGTTATTGGTGTTTTTGCTTCAAAGAGAT
TACCTTTCCCTTCAAGAGCCTTTGACATGGCACATTGTTCTCGTTGTCTT
ATTCCATGGCCTGAATATGATGGACTTTATCTAAATGAAGTTGATAGAAT
TCTACGTCCTGGTGGGTATTGGATTCTATCTGGTCCACCAATTCACTGGA
AGAGATATTGGAAAGGATGGGAAAGAACAAAAGAAGACTTGAATGAAGAG
CAAACCAAAATTGAGAATGTAGCTAAAAGCCTTTGTTGGAATAAAATAGT
GGAGAAAGGTGATATTGCAATTTGGCAGAAACCAAAAAATCATTTAGATT
GCAAATTCACTCAAAATAGGCCTTTTTGCCAAGAGCAAAATAATCCTGAC
AAAGCATGGTACACAAACATGCAAACATGTTTAAATCCACTCCCTAAAGT
GTCCAACAAAGAAGAAATTTCAGGTGGGGAATTAAATAATTGGCCTCAAA
GACTAAAATCAACCCCACCAAGGATTTCAAAGGGGACCATTAAAGGTGTC
ACACCCCAAACATTCTCAAAAGACAATCAACTATGGAACAAAAGAGTATC
ATATTACAAAAAAGTTAACAATCAACTTGAAAAAGCTGGTAGATACAGGA
ACCTATTAGACATGAATGCTTATTTGGGTGGATTTGCAGCTTCACTTGTT
AAATATCCTATTTGGGTTATGAATGTTGTTCCTATTCAAGCTAAAGTTGA
TACACTTGGAGCAATATATGAAAGAGGGTTGATTGGAATGTATCATAATT
GGTGTGAAGCTATGTCTACTTATCCTAGAACTTATGACCTAATTCATGCT
GATTCTGTGTTTAGCCTTTATAATGACAGATGTGAATTGGAAGACATATT
GCTAGAGATGGATAGGATTCTTAGACCAGAAGGAAGTGTAATAATTAGAG
ATGATGTTGATATATTGGTCAAAGTAAAGAGCATAATCAATGGCTTGGAA
TGGGAGAGTCAAATTGTGGACCATGAAGATGGGCCTCTTGAAAGGGAGAA
ACTTTTATTTGCTGTGAAGAAATATTGGACCTCTCCTGCCTCAAATGATA
ATACTATTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated