Overview
NameMedtr0019s0100.1
Unique NameMedtr0019s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3291
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006952 defense response
biological_process GO:0045087 innate immune response
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
biological_process GO:0007165 signal transduction
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0031224 intrinsic component of membrane
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0004888 transmembrane signaling receptor activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00560.2856138-56088834-8501-1712.37.3e-0532.72.4e-08
PF00931.1758013-57252209-4627-269153.42.9e-48154.62.1e-45
PF01582.1558574-5816722-1571-140119.83.1e-38121.02.2e-35
PF05729.757959-57534227-3685-16124.58.9e-0928.68e-07
PF13504.156717-56673641-6552-153.20.08822.46.1e-05
PF13676.158574-5829322-1151-8741.65.7e-1442.93.8e-11

Homology
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|356561802|ref|XP_003549167.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|356573485|ref|XP_003554889.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|356570357|ref|XP_003553356.1| (PREDICTED: TMV resistance protein N-like [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083319|gb|ADF78113.1| (Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083303|gb|ADF78105.1| (Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083307|gb|ADF78107.1| (Rj2 protein [Glycine max] >gi|295083315|gb|ADF78111.1| Rj2 protein [Glycine max] >gi|295083317|gb|ADF78112.1| Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083311|gb|ADF78109.1| (Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083309|gb|ADF78108.1| (Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083313|gb|ADF78110.1| (Rj2 protein [Glycine max])
BLAST of Medtr0019s0100.1 vs. NCBI nr
Match: gi|295083331|gb|ADF78119.1| (Rj2 protein [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356561802|ref|XP_003549167.1|0.000000e+056.19PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|356573485|ref|XP_003554889.1|0.000000e+056.03PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|356570357|ref|XP_003553356.1|0.000000e+055.72PREDICTED: TMV resistance protein N-like [Glycine ... [more]
gi|295083319|gb|ADF78113.1|0.000000e+056.69Rj2 protein [Glycine max][more]
gi|295083303|gb|ADF78105.1|0.000000e+056.69Rj2 protein [Glycine max][more]
gi|295083307|gb|ADF78107.1|0.000000e+056.59Rj2 protein [Glycine max] >gi|295083315|gb|ADF7811... [more]
gi|295083311|gb|ADF78109.1|0.000000e+056.63Rj2 protein [Glycine max][more]
gi|295083309|gb|ADF78108.1|0.000000e+056.75Rj2 protein [Glycine max][more]
gi|295083313|gb|ADF78110.1|0.000000e+056.54Rj2 protein [Glycine max][more]
gi|295083331|gb|ADF78119.1|0.000000e+056.66Rj2 protein [Glycine max][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000157Toll-Interleukin receptorSMARTSM00255no descriptioncoord: 19..162
score: 2.3
IPR000157Toll-Interleukin receptorPROFILEPS50104TIRcoord: 18..162
score: 27
IPR000157Toll-Interleukin receptorSUPERFAMILY52200Toll/Interleukin receptor TIR domaincoord: 8..165
score: 1.2
IPR000767Disease resistance proteinPRINTSPR00364DISEASERSISTcoord: 224..239
score: 3.6e-21coord: 299..313
score: 3.6e-21coord: 392..406
score: 3.6e-21coord: 684..700
score: 3.6
NoneNo IPR availableGENE3D3.40.50.10140no descriptioncoord: 18..138
score: 8
NoneNo IPR availableGENE3D3.40.50.300no descriptioncoord: 212..347
score: 3.1
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 555..886
score: 1
NoneNo IPR availableSEGsegsegcoord: 6..15
score: NAcoord: 757..767
score: NAcoord: 1060..1092
score
NoneNo IPR availableSUPERFAMILY46785"Winged helix" DNA-binding domaincoord: 427..538
score: 9.5
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 512..927
score: 2.9
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 183..429
score: 5.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0100.1 ID=Medtr0019s0100.1|Name=Medtr0019s0100.1|organism=Medicago truncatula|type=mRNA|length=3291bp
ATGGCTATGCTTCAATCATCCATCTCTTCCTCCTCTTCCTTCTCCTATGG
ATTCACCTATCACGTGTTCCTTAGCTTTAGAGGTTGTGACACTCGCTATG
GTTTTACTGGAAATCTCTACAGAGCTCTTTGTGACAAGGGAATCCGAACC
TTCATGGATGACAGAGAGCTTCAAGGAGGTGACGAAATAACACCATCACT
TTTCAAGGCCATTAAAGAGTCTAGGATTTTCATTCCCGTCTTGTCTATCA
ACTATGCTTCTTCTTCATTTTGCTTGAACGAACTTGTCCACATCATTCAC
TGCTTCGAGGAATATGGGCGCCTAGTTTTGCCAATTTTCTATGACGTGGA
ACCTTCTCACGTGCGACATCAAGATGGAAGTTATGGTAAAGCACTTGCCG
AGCATATTGAGAGGTTCCAAAATAGCAAGGATAGCATAGAGAGGTTGCAG
AAATGGAAGACAGCTCTTACTCAGACTGCTAACTTCTCTGGCCACCATTT
CAATACTAGGAATGGATATGAATGCGAGTTTATTGAGAAGATAGTCAAAT
ATGTATCTAACAAGATCAATCATGTTCCTTTATATGTTGCCGATTACCCT
GTTGGTATCGAATCTAGGGTCCTAAAAGTAAATTCACTTCTGGATGTTAG
ATCTAATGGTGAAGTTCAGATGCTAGGGATCTACGGAATTGGAGGAATGG
GAAAGACAACACTTGCTAGAGCAGTTTTTAATTCCATAGCCGATCAATTT
GATGATTTGTGTTTTCTTCACGACGTAAGGGAAAATTCAGCTAAATATGG
TTTAGAGCATCTGCAGGGAAAACTTCTTTCCAAATTAGTTGAATTGGACA
TTAAGTTAGTAGATGTCAACGAGGGAATTCCAATCATAAAGCAAAGGCTT
CACCGAAAGAAGGTTTTGTTGATTCTCGATGATGTTCACGAGCTGAAGCA
ATTACAGGTTTTGGCTGGAGGACTTGATTGGTTTGGTCCTGGTAGTAAAG
TGATCATTACCACTCGAGACGAACAATTGCTAGCAGGTCATGGGATTGAA
AGAGCATATGAAATAGATAAGTTAAATGAGAAAGAAGCTCTTGAATTGTT
GAGGTGGAATGCTTTCAAAAATAACAAAGTCAATCCAAATTTCGACAACG
TTTTACACCTTGCAGTAACTTATGCTTCAGGCCTTCCATTGGCCTTAGAA
GTAGTGGGTTCGAACTTGTTTGGAAAGAATATAGGAGAATGGAAATCTGC
ATTAAATCAGTATGAAAGGATTCCCATTAAAAAGATCCAAGAGATACTTA
AAGTAAGCTTTGATGCTTTGGAGGAAGATGAGAAGAATGTTTTTCTCGAC
ATTTCTTGTTTCTTAGAAGGATGTGATTTAAAAGAAGTTGAAGATATACT
TCATGCTCATTATGGTAGCTGCATGAAACATCAAATTAGAGTGTTGCATG
AAAAATCTCTCATAAAGATCAAATGGTACCAGGGGAATTATGTTGTGACG
TTACATGCCTTGATAGAGAAAATGGGTAAAGAAATTGTCCGCAAAGAGTC
TCCAAAAGAGCCTGGAAGACGTAGTAGGTTATGGTTCCATAAAGATATAA
TTTATGTCTTAGAAGAAAATAAGGGATCAAGTGAAATTGAAATTATATAT
TTGGAATTCCCGTTATGTGAGAAAGAGGTGGTAGATTGGAAGGGAGATGA
ACTCAAGAAGATGCAAAACCTCAAAACACTTATTGTTAAGAATGGTAGCT
TTTCCAAAGGTCCTAAACATCTTCCTAACAGTTTGAGAGTATTGGAATGG
CGTAAATATCCTTCACGGTTCGTACCATCTGATATTTTCCCGAAGAAACT
TTCTATATGCAAACTACAGCAAAGTGACTTTACATCATTCGAGTTGCGTG
GGACAATCAAGAGGTTTGTGAATATGAGAGAGTTAAATCTAGACAAATGT
CAATATTTAACACGGATACATGACATCTCCGATCTCCCAAATTTAGAAAT
ATTTTCATTTAAAAATTGTAAGAATTTAATTGAAATTCACAAATCTGTCG
GGTTCCTAAATAAACTTGAAATCTTGAACGCGGAAGGTTGCAGCAAGCTC
ACGAGTTTCCCACCTCTGAAGTCGACCTCTCTTCAAGAACTGAGGCTTTC
ATATTGTGAGAGTCTTAAGACTTTTCCAGAAATATTAGGAGAGATGAAGA
ATATAACACGTATTCGTTTGTTTGACACTTCCATCGAAAAACTGCCTGTT
TCATTTCAAAAACTCACGGGGCTTCTTAACTTAATTATAATAGGAAATGG
AATGCTTAGATTGCCAAGTAGTATTTTTAGGATGCCAGCTCTGTCAAAAA
TAAATTTTGAGGATTGTCTACTTCCAAAGAAAAATGATAAATTGAGTTCC
ATGGTGTTTACAAGCCGAGCAGTAGACATCGAATACATTGAATTGATAAA
ATGCAACTTATCAGATAAATTTCTTCCAATACTTGTCATGTGGTCTGCTA
ATGTGAAAACTTTAGACCTATCAGGAAATAATTTCACAATTCTTCCGGAA
TGCATGAAAGATTGTCGCTTTTTGTGGTTTCTTAAATTGGATGATTGCAA
GTGCCTTCGAGAAATTAGAGGGATTCCACCAAATGTAAAACACTTGTCTG
CAATACGCTGCAAATCATTGACTTCCTCGTGCAAACACATGCTATTGAAT
CAGGATATGCATGAGGCTGGACAAACCATGTTTTGTTTGCCGGGATTTGC
AAGGATTCCAGAGTGGTTTGAGCACCAAAACATGGGACATACGATTTCTT
TTTGGTTTCGTAACAAGCTCCCTTCCACGGCTCTCTTTTTTTCTACTAAA
TCAGTTGCTACATCCAGGACTAATAATTTTGATATTGATATACCCACTCT
AATCATCAACGACAATATAAATGGTTTTCCAGTTCTGATGATTGATTTTG
GTCTAATGTCGACTCATCATATATATTTGTGTGATATGAAACTGGGATTT
ACTCAAATCCACAGCATGGAGAAAATAATTTTAGAAAATGAATGGATCCA
TGCAGAGGTTACATGTGAACATCCGAAGGTGGAACCACTAACAGAAATTG
GAATCCATTTTTTCAAACAGAAAAATAACATGGATGATATTCAATTCACC
AATCCTTATGAAAAGATAAAATTAAATGATAATGATGATGATGGTGATGA
TGTTTTTTATGAAGTTGACGATGTTCTAGATGATGATAATGATGGTGTCT
TTTATGATGTTGATGATGAAGACGACCACCATTCACAATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000157Toll-Interleukin receptor
IPR000767Disease resistance protein
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004888transmembrane signaling receptor activity
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Biological Process
TermDefinition
GO:0007165signal transduction
GO:0045087innate immune response
GO:0006952defense response
GO:0006950response to stress
GO:0008150biological_process
GO:0050896response to stimulus
Vocabulary: Cellular Component
TermDefinition
GO:0031224intrinsic component of membrane
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part