Overview
NameMedtr0019s0090.1
Unique NameMedtr0019s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length318
Homology
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|502144164|ref|XP_004505600.1| (PREDICTED: cellulose synthase-like protein D3-like isoform X1 [Cicer arietinum] >gi|502144167|ref|XP_004505601.1| PREDICTED: cellulose synthase-like protein D3-like isoform X2 [Cicer arietinum])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|391225931|gb|AFM37967.1| (cellulose synthase-like protein D [Cunninghamia lanceolata])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|470128536|ref|XP_004300194.1| (PREDICTED: cellulose synthase-like protein D3-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|356538575|ref|XP_003537778.1| (PREDICTED: cellulose synthase-like protein D2-like [Glycine max])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|147821627|emb|CAN70317.1| (hypothetical protein VITISV_038092 [Vitis vinifera])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|414867941|tpg|DAA46498.1| (TPA: putative cellulose synthase-like family protein [Zea mays])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|297742034|emb|CBI33821.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|242078801|ref|XP_002444169.1| (hypothetical protein SORBIDRAFT_07g011890 [Sorghum bicolor] >gi|241940519|gb|EES13664.1| hypothetical protein SORBIDRAFT_07g011890 [Sorghum bicolor])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|218201003|gb|EEC83430.1| (hypothetical protein OsI_28899 [Oryza sativa Indica Group])
BLAST of Medtr0019s0090.1 vs. NCBI nr
Match: gi|172046165|sp|Q7EZW6.2|CSLD3_ORYSJ (RecName: Full=Cellulose synthase-like protein D3; AltName: Full=OsCslD3)
The following BLAST results are available for this feature:
BLAST of Medtr0019s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502144164|ref|XP_004505600.1|1.150510e-735.94PREDICTED: cellulose synthase-like protein D3-like... [more]
gi|391225931|gb|AFM37967.1|1.335190e-575.00cellulose synthase-like protein D [Cunninghamia la... [more]
gi|470128536|ref|XP_004300194.1|1.967540e-575.00PREDICTED: cellulose synthase-like protein D3-like... [more]
gi|356538575|ref|XP_003537778.1|3.927090e-575.00PREDICTED: cellulose synthase-like protein D2-like... [more]
gi|147821627|emb|CAN70317.1|4.322380e-575.00hypothetical protein VITISV_038092 [Vitis vinifera... [more]
gi|414867941|tpg|DAA46498.1|4.631690e-567.65TPA: putative cellulose synthase-like family prote... [more]
gi|297742034|emb|CBI33821.3|4.657040e-575.00unnamed protein product [Vitis vinifera][more]
gi|242078801|ref|XP_002444169.1|6.223900e-570.59hypothetical protein SORBIDRAFT_07g011890 [Sorghum... [more]
gi|218201003|gb|EEC83430.1|6.368330e-570.59hypothetical protein OsI_28899 [Oryza sativa Indic... [more]
gi|172046165|sp|Q7EZW6.2|CSLD3_ORYSJ7.122240e-570.59RecName: Full=Cellulose synthase-like protein D3; ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 93..105
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0090.1 ID=Medtr0019s0090.1|Name=Medtr0019s0090.1|organism=Medicago truncatula|type=mRNA|length=318bp
ATGTCATCAAAACCTTTCAAAGTAAGAAGATCGTCACTATCAGCAACTTC
TGATGATTTTGTTGATCCAACTGAGTTGATGAGCGCACAATGGAAACCGC
TTACACGAAAACTTCATTATATTCATTCGTATGATGGCTCTTGCACTGTT
CTTGCATTGGAGGGTCACACACAAAAATACCGATGCAATCTGGAAAAATT
TGAAACACCAAATCCTGACAATCTGCCAGGCATAGACGTCTTTGTCTCAA
CTGCCGATCCTGAGAAAGAAACCGTCTCTTGTCACAGCAAACACCATTCT
GTCCATTCTGGCAGCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated