Overview
NameMedtr0019s0080.1
Unique NameMedtr0019s0080.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length540
Homology
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147859821|emb|CAN81442.1| (hypothetical protein VITISV_011546 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147834026|emb|CAN70998.1| (hypothetical protein VITISV_023635 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|359486871|ref|XP_002272748.2| (PREDICTED: uncharacterized protein LOC100256388 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147805881|emb|CAN76026.1| (hypothetical protein VITISV_027817 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147801054|emb|CAN77850.1| (hypothetical protein VITISV_020834 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147814799|emb|CAN65498.1| (hypothetical protein VITISV_028324 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147858394|emb|CAN81408.1| (hypothetical protein VITISV_010447 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|147817232|emb|CAN64191.1| (hypothetical protein VITISV_016956 [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|359487996|ref|XP_002284948.2| (PREDICTED: 39S ribosomal protein L45, mitochondrial-like [Vitis vinifera])
BLAST of Medtr0019s0080.1 vs. NCBI nr
Match: gi|356518961|ref|XP_003528143.1| (PREDICTED: uncharacterized protein LOC100778359 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0080.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|147859821|emb|CAN81442.1|1.455620e-646.00hypothetical protein VITISV_011546 [Vitis vinifera... [more]
gi|147834026|emb|CAN70998.1|4.529350e-646.94hypothetical protein VITISV_023635 [Vitis vinifera... [more]
gi|359486871|ref|XP_002272748.2|1.024970e-535.96PREDICTED: uncharacterized protein LOC100256388 [V... [more]
gi|147805881|emb|CAN76026.1|1.085750e-535.96hypothetical protein VITISV_027817 [Vitis vinifera... [more]
gi|147801054|emb|CAN77850.1|1.114660e-535.96hypothetical protein VITISV_020834 [Vitis vinifera... [more]
gi|147814799|emb|CAN65498.1|1.324710e-546.94hypothetical protein VITISV_028324 [Vitis vinifera... [more]
gi|147858394|emb|CAN81408.1|1.484820e-548.94hypothetical protein VITISV_010447 [Vitis vinifera... [more]
gi|147817232|emb|CAN64191.1|1.894750e-547.73hypothetical protein VITISV_016956 [Vitis vinifera... [more]
gi|359487996|ref|XP_002284948.2|2.040620e-546.00PREDICTED: 39S ribosomal protein L45, mitochondria... [more]
gi|356518961|ref|XP_003528143.1|2.093340e-532.22PREDICTED: uncharacterized protein LOC100778359 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0080.1 ID=Medtr0019s0080.1|Name=Medtr0019s0080.1|organism=Medicago truncatula|type=mRNA|length=540bp
ATGCCTTTTCCTTCTTCAAAGCGCCAGCAGGGTCATAGGAAAGTTTCTTG
TATTGACTGGAACACCATTTGTAAGGAGAAGGAGGTTGATGGTTTGGGGG
TAAGGAGAATTATAGAGTTTAACATTGCTCTTTTGGGTAGATGGTGTTGG
AGGATGGTGACTGATAGGGTGAGTTATGGTTTAGAGTGTTGGCCGCTAGG
TATGGTAATTGAGGGCAGTTCGCTGAGGGAAGGGGGGAGAAACGGTTCTG
TTTGGTGGCAACAGATGGCTCGTATTCGGGAGGGTGTTGGTGTTCAGGTA
GATGGCTGGTTTGAGGAAAAATTGAGTCGGCGGTGGGGGATGGAACGTAT
ACTTACTTTTGGTCAGACAGGTGGTTGGGGGGAGATGTGCTTGGTGTTTG
GTTCCGACGTTTGTTTGAGTTGTCTGTTAACAAATGGGCGTTGGTGTCGC
ACATGGCTAGGTTCAATGTTCAGATCGATGTGTGTTGTTACCGGATCCTC
CTACAGGGTATACGGGCGCATACACCCTCCTCACCAGTGA
back to top