Overview
NameMedtr0019s0070.1
Unique NameMedtr0019s0070.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1371
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00612.2246191-46132118-1372-2128.29.9e-1139.51.6e-10
PF13178.145507-45280346-4212-7749.74.4e-1749.73e-13

Homology
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|502175393|ref|XP_004515721.1| (PREDICTED: protein IQ-DOMAIN 14-like [Cicer arietinum])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|356561701|ref|XP_003549118.1| (PREDICTED: protein IQ-DOMAIN 14-like [Glycine max])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|356529263|ref|XP_003533215.1| (PREDICTED: protein IQ-DOMAIN 14-like [Glycine max])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|356575931|ref|XP_003556089.1| (PREDICTED: protein IQ-DOMAIN 14-like [Glycine max])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|590672454|ref|XP_007038616.1| (IQ-domain 24, putative [Theobroma cacao] >gi|508775861|gb|EOY23117.1| IQ-domain 24, putative [Theobroma cacao])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|255539521|ref|XP_002510825.1| (conserved hypothetical protein [Ricinus communis] >gi|223549940|gb|EEF51427.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|224136968|ref|XP_002322461.1| (calmodulin-binding family protein [Populus trichocarpa] >gi|222869457|gb|EEF06588.1| calmodulin-binding family protein [Populus trichocarpa])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|502119371|ref|XP_004496596.1| (PREDICTED: protein IQ-DOMAIN 14-like [Cicer arietinum])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|596021841|ref|XP_007219045.1| (hypothetical protein PRUPE_ppa004660mg [Prunus persica] >gi|462415507|gb|EMJ20244.1| hypothetical protein PRUPE_ppa004660mg [Prunus persica])
BLAST of Medtr0019s0070.1 vs. NCBI nr
Match: gi|449485626|ref|XP_004157228.1| (PREDICTED: uncharacterized LOC101216161 [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0070.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502175393|ref|XP_004515721.1|0.000000e+076.02PREDICTED: protein IQ-DOMAIN 14-like [Cicer arieti... [more]
gi|356561701|ref|XP_003549118.1|0.000000e+070.19PREDICTED: protein IQ-DOMAIN 14-like [Glycine max][more]
gi|356529263|ref|XP_003533215.1|0.000000e+068.44PREDICTED: protein IQ-DOMAIN 14-like [Glycine max][more]
gi|356575931|ref|XP_003556089.1|1.636770e-15963.37PREDICTED: protein IQ-DOMAIN 14-like [Glycine max][more]
gi|590672454|ref|XP_007038616.1|8.397440e-14258.02IQ-domain 24, putative [Theobroma cacao] >gi|50877... [more]
gi|255539521|ref|XP_002510825.1|1.055010e-13557.94conserved hypothetical protein [Ricinus communis] ... [more]
gi|224136968|ref|XP_002322461.1|1.454750e-13057.29calmodulin-binding family protein [Populus trichoc... [more]
gi|502119371|ref|XP_004496596.1|3.855340e-13059.11PREDICTED: protein IQ-DOMAIN 14-like [Cicer arieti... [more]
gi|596021841|ref|XP_007219045.1|3.449350e-12453.97hypothetical protein PRUPE_ppa004660mg [Prunus per... [more]
gi|449485626|ref|XP_004157228.1|1.333940e-11856.80PREDICTED: uncharacterized LOC101216161 [Cucumis s... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000048IQ motif, EF-hand binding siteSMARTSM00015no descriptioncoord: 115..137
score: 2.4e-05coord: 138..159
score
IPR000048IQ motif, EF-hand binding sitePROFILEPS50096IQcoord: 116..144
score: 11.061coord: 140..167
score: 9
NoneNo IPR availableSEGsegsegcoord: 11..28
score: NAcoord: 41..56
score: NAcoord: 63..88
score: NAcoord: 91..101
score: NAcoord: 131..150
score: NAcoord: 284..299
score
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 109..169
score: 1.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0070.1 ID=Medtr0019s0070.1|Name=Medtr0019s0070.1|organism=Medicago truncatula|type=mRNA|length=1371bp
ATGAACTTTCTCCGACGACTCTTCGGCGGCAAAAAACACCGTAATCCACC
ACCAGAACCACCCACCAACAACAAAAAAGACAAAAGAACATGGAGTTTCA
CAAAGAACAACACAAGACAAAAAACAAACAAAAGTTCTGACCCTTCAACT
TCTTCTTTCTCTGATAACTATGATGCTAATAAACATGCCATTGCTGTTGC
TGCTGCTACTGCCGCCGTTGCTGAAGCTGCACTCGCTGCTGCTCATGCTG
CCGCTGAGGTTGTTAGATTGACAAGTAATACGACTACTGGAAATTCTTCC
GGAGCACCTCGAACTCCGACAACTGTCAGGAGACGGTTGTCGGACGAAAT
TGATGCTGCCGTGAAGATTCAGTCGGCTTTCCGAGGTTATTTGGCAAGGA
GGGCATTAAGAGCACTTAAAGCATTGGTGAAATTGCAAGCATTAGTGAGA
GGTCACATTGTAAGAAAGCAGACAGCTGATATGCTAAGACGAATGCAAAC
ATTGGTTCGACTTCAGTCTCGGGCACGCGCAAGTCGTGTGCACATTTCCG
ATAATATGCACTCTTTCAAGTCTTCGCTTTCTCATTACCCTGTTCCTGAT
GATTATGAGCACCCACTTCGTGTCTATAGTACGAAATTTGATGGATCTTC
CATCCTCAAGAGATGTAGTTCAAATGCAAATTTTAGAGACATGAACTTAG
AAAGAGCGCGGTTTGGTTCAAATTGGTTAGACAGTTGGATGGAAGAAAAC
ACATGGAGCCAAACCGGCGACACTTCATCGAAAAATGTAAATGATGATGA
GAAGAGTGACAAAATTCTTGAAGTAGATACTTGGAAACCACATTTGAAAT
CACAACATAGTACTAGCACCTCTTTTCAACATCATTATTCATCTTCTGAT
TACAATAATGAAAATTTGATGGTACAAGATTCGCCGTCAAAACGTTCTTC
TAAAGCTTATAATCCAAGTCTCTCTTCTATGAAGCATCAGAAAGGAAAAG
AAGAAGAAGTAGCTTCTTTGCGAACCGCCGAGAGTAGTCCACAGGCATTT
TCGGCTTCTTCAAGACTCGAAAGTGGTTCGAGGAGAGGTCCTTTTACACC
TACTAAAAGTGAGAGTTCATGGGGATTTTTCAATGCTCACTCTGGTTATC
CTAGTTATATGGCAAATACTCAATCTTCTAGGGCTAAGGTTAGGTCACAA
AGTGCTCCAAGACAAAGGCTTGAGTTTGAGAGATACGGTTCATCTAATAG
GTCTATTCAAGGTCTTTGGGAATCAGGGTCTAATTCAGAAATAGATTCTG
ATTTTAGGAGCAAGGTTTATCCAACCACAAGTAGCTTGAACAGAATTGGG
AGTAGTACCAATTTAAGGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000048IQ motif, EF-hand binding site
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding