Overview
NameMedtr0019s0020.5
Unique NameMedtr0019s0020.5
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3396
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0003674 molecular_function
molecular_function GO:0005342 organic acid transmembrane transporter activity
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00005.228482-8150613-7231-11769.15.3e-2370.11.8e-19
PF00664.189553-8771256-5162-26475.46.1e-25149.88.8e-44

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0020.5 ID=Medtr0019s0020.5|Name=Medtr0019s0020.5|organism=Medicago truncatula|type=mRNA|length=3396bp
ATGGATGATCTTTGGAGTATAATTTGCTTTAGTGTGTTCCTGCTAATAAT
CATGTTTGCATTCATCATCATGATCCTAAAGACTTCTTCAAGAAGACCCT
TTTGGAGTCTGGTAAGATATTCAAACTTGCAACTGGTATCTGCCATAACA
ATTATCTTTATTGGTCTGCTGCGTTTATCGTTAGGAATTAACGGATGGTG
GATCGATCTCTTTCATGGATTCACATGGTTGTTAGTAAGTTTAATTGTAA
GTCTTCAGATAAAACAACTCACAAGAGCATGGTTGTGGATGTTTTCTTTT
TTCATGTTCTTTGTTTCTGGTGTATTATGTTCTTTATCCATGTCTTCTTA
TGCAATCGGTAGTAGCGAACTCTCCTTCAATGCAGCTTTAGATGTTTTAT
CTTTTTCAGGAGCAACTTTACTTCTGTTATGCACATACCAAGTGTGTACG
GGTAAATCCATTGATGAAAGCTTTTATGCTCCATTAAATGGTCAGATCAA
CGAAGTTGATCCTGTTAGCAATATAACCCCATTTTCGAAGGCTGGATTCT
TCAGTAAGATTTCGTTTTGGTGGTTAAATCCATTGATGAAAAGGGGTCAA
GAGAAAACACTTGTAGACGAGGATATCCCGAAGTTAAGAGAGTTTGACCG
TGCAAAAAGTTGTTATTTGTCATTTGTAGAACAGTTAAACAAACAAAAAC
AACATGAATCATCATTATATTCGTCGGTCTTTTGGACAATAATTTTGTGC
TACCAGAGAGAGATTTTGATAACAGGACTCTTTGCTTTGCTCAAGGTACT
TGCTCTAACTTCTGGTCCTCTATTTCTGAATGAATTTATATCGGTTGCTG
AAGGCAATACAAGTTTCAATTATCAGGGTTATATATTAGCGATATCACTC
TTCTTTATAAAGATCATTGGATCCGTATCACAAAGACAATGGTATTTCCG
GAGTAGACTTGTTGGGATGAAAGTTAGATCACTACTTAATGCATCCATTT
ATAAAAAAATATTAAGGTTGTCCAATTCTGCTAGATTGATTCACTCTAGT
GGTGAGATAATCAATTATATAATCGTAGATGCTTATAGAATTGGAGAATT
TCCGGTTTGGTTTCACCAGACTTGGACAACAAGCCTCCAACTGTGTATTG
CATTAGTAATTCTTTTCCGCACAATTGGACTAGCAATTCTAGCATCATTG
GCAATGATAATTCTCACTATGCTTTGCAATGCTCGCCTAGCCAAGTTAGA
GCACAAGTTTCAAAGGCAACTTATGGTGGCACAAGATGAGAGATTAAAGG
CTAGTTTTGAGTCTTTTGTTACTATGAAAGTGTTGAAGTTATATGCATGG
GAAACACATTTTAAAAATGTTGTATATTACTTACGAAATGTGGAACTCAA
ATTGCTATCAGCAGTGCAGTTAAGAAAGGCGTTCTCTGTCTTTATCGTTT
GGACATCACCATTGTTGGTATCTGCTGCTTCTTTTCTAGCATGTTATTTT
CTGAAAGTTCCTTTGCATGCAAGTAATGTTTTCACTATTGTGGCAACTTT
GCGTCTCATTCAAGAACCAATTTCAAGCATCCCAGATGTTATTGCAGTGA
TCATTGAGGCAAAAGTTGCGTTCTCTCGGATTGTTAATTTCCTTGAGGCA
CCGGAACTGCAGAGAGAAAATTTCAAGAAAAAATGCTTCAATGATAACCT
TAAAGGCTCAATTTCAATAAAATGTTCTGACTTTTCATGGGAAGGTAATG
CATCAAAACCAACACTAAGGAACATAAGTATGGAGGTTAGACATGGGCAA
AAGGTGGCTATTTGTGGAGAAGTTGGCTCAGGAAAATCAACTCTCATTGC
AACAATTCTTGGAGAAGTTTCAAAAACAAAGGGAACGATTGACGTTCAAG
GGAAGTTTGCGTATGTTTCTCAAACAGCATGGATACAAACAGGAACAGTA
CGTGAAAATATTTTGTTTGGATCTGAGTTGGATGATCAAAGATATCAAGA
GACACTTCAAAAGTCTTCACTGGTAAAGGACCTTGAGTTGCTTCCCTATG
GTGACCTCACTGAAATAGGTGAGAGAGGAGTTAATTTAAGTGGAGGTCAA
AAGCAGCGAATTCAACTTGCTCGTGCTCTTTATCAGAATGCTGATATATA
TCTATTAGATGATCCATTTAGTGCTGTTGATGCGCATACTGCGAAAAATT
TGTTTAATGAATACATCATGGAAGGACTCAAAGGGAAAACACTCATACTT
GTTACTCATCAAGTTGACTTCCTCCCAGCCTTTGATTCTATTTTGTTGAT
GTCTAATGGGGAAATCCTACAATCTGGTCCATATCACCAACTAATGACCT
CAAGCCAAGAATTCAATAACCTTGTCAATGCTCGCAAAGAGACTGCTGGT
TCTGACCTACTTGCAAGTGCTACTTTTTCCGAAAGACATTCAACTTCCAT
AAAGAGTATGCAAGCTTCGGTGTTGAAGCAGTATAAAGCACCAAATGGAA
ATCAATTGATTCATCAAGAAGAGAGAGAGAAAGGCGACACAGGATTGAAG
CCTTACTTACAATATCTGAATCAGATGAAAGGCTATATATTATTCTCTAC
GGCTTTTCTTTGTCACCTTATTTTTGTGTTTTGTCAGATATTGCAAAACT
CGTGGATGGCTTCTAATGTTGACAATCCCCTTGTCAGCACATTGCGATTG
ATTTTAGTTCATCTCCTTATCGGTGGTTTTTCAACAGTTTTTTTGTTCAT
CAGATGTCTACTTATAGTTACTTTGGGTCTTAAATCATCAAAAGATTTAT
TTTCACAACTGATGAATTCCCTCTTTCATGCACCTATGTCATTTTATGAT
TCAACACCATTGGGAAGGATACTTAGTAGGGTCTCGTCTGATCTAAGCAT
TATGGATCTTGACCTGCCCTTTAGCCTCAGTTATTCAATGGGAGCCACTA
TAAATTTTTATTCTAGTCTTACAGTTTTAGCAGTTGTCACATGGCAAGTC
TTAATTGTCGCTATACCAATGGTTTATGTAGTTATTCGCATGCAGAGATA
CTACATTGCCTCTGAAAAAGAAGTAATGAGGATGAATGGCACCACAAAGT
CGTCATTAGCTAATCATGTAAATGAAACTGTTGCTGGAGCTGCAACTATA
AGGGCTTTTGAGGAGGAAGATTGTTTTTTTGAGAAAAACCTTGACCTAAT
TGATATAAATGCTAGTGCTTTTTTCCATAGTTTTTCCTCAAAAGAGTGGT
TGATCCAACGGTTAGAAATAATCAGTGCAGTTGTTCTTACCACTGGAGCA
CTTTGCATGGTTATGCTCCCTCCTGGAACATTCACCTCAGGTGAGAATTT
GGTCATTATTTTATCGGAAATGTCGTGGTTTGTTCGAGCATTGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0005215transporter activity
GO:0022857transmembrane transporter activity
GO:0005342organic acid transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022892substrate-specific transporter activity
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process