Overview
NameMedtr0019s0020.1
Unique NameMedtr0019s0020.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length4278
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
biological_process GO:0055085 transmembrane transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0016021 integral component of membrane
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0005524 ATP binding
molecular_function GO:0016887 ATPase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0017111 nucleoside-triphosphatase activity
molecular_function GO:0000166 nucleotide binding
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00005.228482-8150613-7231-11768.74.3e-22142.56.6e-42
PF00664.189553-8771256-5162-26474.95.3e-24150.84.2e-44

Homology
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|502171849|ref|XP_004515114.1| (PREDICTED: ABC transporter C family member 10-like isoform X1 [Cicer arietinum])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|356561462|ref|XP_003549000.1| (PREDICTED: ABC transporter C family member 10-like [Glycine max])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|356561460|ref|XP_003548999.1| (PREDICTED: ABC transporter C family member 10-like [Glycine max])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|502119079|ref|XP_004496497.1| (PREDICTED: ABC transporter C family member 10-like [Cicer arietinum])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|356535814|ref|XP_003536438.1| (PREDICTED: ABC transporter C family member 10-like isoform X1 [Glycine max])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|356534063|ref|XP_003535577.1| (PREDICTED: ABC transporter C family member 10-like, partial [Glycine max])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|596017635|ref|XP_007218886.1| (hypothetical protein PRUPE_ppa000197mg [Prunus persica] >gi|462415348|gb|EMJ20085.1| hypothetical protein PRUPE_ppa000197mg [Prunus persica])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|255545090|ref|XP_002513606.1| (multidrug resistance-associated protein 1, 3 (mrp1, 3), abc-transoprter, putative [Ricinus communis] >gi|223547514|gb|EEF49009.1| multidrug resistance-associated protein 1, 3 (mrp1, 3), abc-transoprter, putative [Ricinus communis])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|224116838|ref|XP_002331826.1| (multidrug resistance protein ABC transporter family [Populus trichocarpa])
BLAST of Medtr0019s0020.1 vs. NCBI nr
Match: gi|359490537|ref|XP_002267650.2| (PREDICTED: ABC transporter C family member 10-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0020.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502171849|ref|XP_004515114.1|0.000000e+076.39PREDICTED: ABC transporter C family member 10-like... [more]
gi|356561462|ref|XP_003549000.1|0.000000e+073.60PREDICTED: ABC transporter C family member 10-like... [more]
gi|356561460|ref|XP_003548999.1|0.000000e+072.19PREDICTED: ABC transporter C family member 10-like... [more]
gi|502119079|ref|XP_004496497.1|0.000000e+072.14PREDICTED: ABC transporter C family member 10-like... [more]
gi|356535814|ref|XP_003536438.1|0.000000e+070.60PREDICTED: ABC transporter C family member 10-like... [more]
gi|356534063|ref|XP_003535577.1|0.000000e+068.98PREDICTED: ABC transporter C family member 10-like... [more]
gi|596017635|ref|XP_007218886.1|0.000000e+067.75hypothetical protein PRUPE_ppa000197mg [Prunus per... [more]
gi|255545090|ref|XP_002513606.1|0.000000e+070.17multidrug resistance-associated protein 1, 3 (mrp1... [more]
gi|224116838|ref|XP_002331826.1|0.000000e+068.63multidrug resistance protein ABC transporter famil... [more]
gi|359490537|ref|XP_002267650.2|0.000000e+067.38PREDICTED: ABC transporter C family member 10-like... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR003439ABC transporter-likePROFILEPS50893ABC_TRANSPORTER_2coord: 573..794
score: 23.890coord: 1179..1413
score: 17
IPR003593ATPase, AAA+ type, coreSMARTSM00382no descriptioncoord: 598..771
score: 1.2e-16coord: 1205..1397
score: 1.8
IPR011527ABC transporter, transmembrane domain, type 1SUPERFAMILY90123ABC transporter transmembrane regioncoord: 841..1193
score: 5.6e-49coord: 206..551
score: 4
IPR017871ABC transporter, conserved sitePROSITEPS00211ABC_TRANSPORTER_1coord: 696..710
score
IPR017940ABC transporter, integral membrane type 1PROFILEPS50929ABC_TM1Fcoord: 256..536
score: 31.354coord: 868..1142
score: 27
NoneNo IPR availableGENE3D1.20.1560.10no descriptioncoord: 244..552
score: 4.6e-19coord: 864..1155
score: 1
NoneNo IPR availableGENE3D3.40.50.300no descriptioncoord: 572..790
score: 1.8e-60coord: 1179..1407
score: 4.5
NoneNo IPR availableSEGsegsegcoord: 13..26
score: NAcoord: 94..109
score: NAcoord: 394..408
score: NAcoord: 1321..1339
score
NoneNo IPR availableSUPERFAMILY52540P-loop containing nucleoside triphosphate hydrolasescoord: 1158..1399
score: 3.6e-53coord: 573..780
score: 2.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0020.1 ID=Medtr0019s0020.1|Name=Medtr0019s0020.1|organism=Medicago truncatula|type=mRNA|length=4278bp
ATGGATGATCTTTGGAGTATAATTTGCTTTAGTGTGTTCCTGCTAATAAT
CATGTTTGCATTCATCATCATGATCCTAAAGACTTCTTCAAGAAGACCCT
TTTGGAGTCTGGTAAGATATTCAAACTTGCAACTGGTATCTGCCATAACA
ATTATCTTTATTGGTCTGCTGCGTTTATCGTTAGGAATTAACGGATGGTG
GATCGATCTCTTTCATGGATTCACATGGTTGTTAGTAAGTTTAATTGTAA
GTCTTCAGATAAAACAACTCACAAGAGCATGGTTGTGGATGTTTTCTTTT
TTCATGTTCTTTGTTTCTGGTGTATTATGTTCTTTATCCATGTCTTCTTA
TGCAATCGGTAGTAGCGAACTCTCCTTCAATGCAGCTTTAGATGTTTTAT
CTTTTTCAGGAGCAACTTTACTTCTGTTATGCACATACCAAGTGTGTACG
GGTAAATCCATTGATGAAAGCTTTTATGCTCCATTAAATGGTCAGATCAA
CGAAGTTGATCCTGTTAGCAATATAACCCCATTTTCGAAGGCTGGATTCT
TCAGTAAGATTTCGTTTTGGTGGTTAAATCCATTGATGAAAAGGGGTCAA
GAGAAAACACTTGTAGACGAGGATATCCCGAAGTTAAGAGAGTTTGACCG
TGCAAAAAGTTGTTATTTGTCATTTGTAGAACAGTTAAACAAACAAAAAC
AACATGAATCATCATTATATTCGTCGGTCTTTTGGACAATAATTTTGTGC
TACCAGAGAGAGATTTTGATAACAGGACTCTTTGCTTTGCTCAAGGTACT
TGCTCTAACTTCTGGTCCTCTATTTCTGAATGAATTTATATCGGTTGCTG
AAGGCAATACAAGTTTCAATTATCAGGGTTATATATTAGCGATATCACTC
TTCTTTATAAAGATCATTGGATCCGTATCACAAAGACAATGGTATTTCCG
GAGTAGACTTGTTGGGATGAAAGTTAGATCACTACTTAATGCATCCATTT
ATAAAAAAATATTAAGGTTGTCCAATTCTGCTAGATTGATTCACTCTAGT
GGTGAGATAATCAATTATATAATCGTAGATGCTTATAGAATTGGAGAATT
TCCGGTTTGGTTTCACCAGACTTGGACAACAAGCCTCCAACTGTGTATTG
CATTAGTAATTCTTTTCCGCACAATTGGACTAGCAATTCTAGCATCATTG
GCAATGATAATTCTCACTATGCTTTGCAATGCTCGCCTAGCCAAGTTAGA
GCACAAGTTTCAAAGGCAACTTATGGTGGCACAAGATGAGAGATTAAAGG
CTAGTTTTGAGTCTTTTGTTACTATGAAAGTGTTGAAGTTATATGCATGG
GAAACACATTTTAAAAATGTTGTATATTACTTACGAAATGTGGAACTCAA
ATTGCTATCAGCAGTGCAGTTAAGAAAGGCGTTCTCTGTCTTTATCGTTT
GGACATCACCATTGTTGGTATCTGCTGCTTCTTTTCTAGCATGTTATTTT
CTGAAAGTTCCTTTGCATGCAAGTAATGTTTTCACTATTGTGGCAACTTT
GCGTCTCATTCAAGAACCAATTTCAAGCATCCCAGATGTTATTGCAGTGA
TCATTGAGGCAAAAGTTGCGTTCTCTCGGATTGTTAATTTCCTTGAGGCA
CCGGAACTGCAGAGAGAAAATTTCAAGAAAAAATGCTTCAATGATAACCT
TAAAGGCTCAATTTCAATAAAATGTTCTGACTTTTCATGGGAAGGTAATG
CATCAAAACCAACACTAAGGAACATAAGTATGGAGGTTAGACATGGGCAA
AAGGTGGCTATTTGTGGAGAAGTTGGCTCAGGAAAATCAACTCTCATTGC
AACAATTCTTGGAGAAGTTTCAAAAACAAAGGGAACGATTGACGTTCAAG
GGAAGTTTGCGTATGTTTCTCAAACAGCATGGATACAAACAGGAACAGTA
CGTGAAAATATTTTGTTTGGATCTGAGTTGGATGATCAAAGATATCAAGA
GACACTTCAAAAGTCTTCACTGGTAAAGGACCTTGAGTTGCTTCCCTATG
GTGACCTCACTGAAATAGGTGAGAGAGGAGTTAATTTAAGTGGAGGTCAA
AAGCAGCGAATTCAACTTGCTCGTGCTCTTTATCAGAATGCTGATATATA
TCTATTAGATGATCCATTTAGTGCTGTTGATGCGCATACTGCGAAAAATT
TGTTTAATGAATACATCATGGAAGGACTCAAAGGGAAAACACTCATACTT
GTTACTCATCAAGTTGACTTCCTCCCAGCCTTTGATTCTATTTTGTTGAT
GTCTAATGGGGAAATCCTACAATCTGGTCCATATCACCAACTAATGACCT
CAAGCCAAGAATTCAATAACCTTGTCAATGCTCGCAAAGAGACTGCTGGT
TCTGACCTACTTGCAAGTGCTACTTTTTCCGAAAGACATTCAACTTCCAT
AAAGAGTATGCAAGCTTCGGTGTTGAAGCAGTATAAAGCACCAAATGGAA
ATCAATTGATTCATCAAGAAGAGAGAGAGAAAGGCGACACAGGATTGAAG
CCTTACTTACAATATCTGAATCAGATGAAAGGCTATATATTATTCTCTAC
GGCTTTTCTTTGTCACCTTATTTTTGTGTTTTGTCAGATATTGCAAAACT
CGTGGATGGCTTCTAATGTTGACAATCCCCTTGTCAGCACATTGCGATTG
ATTTTAGTTCATCTCCTTATCGGTGGTTTTTCAACAGTTTTTTTGTTCAT
CAGATGTCTACTTATAGTTACTTTGGGTCTTAAATCATCAAAAGATTTAT
TTTCACAACTGATGAATTCCCTCTTTCATGCACCTATGTCATTTTATGAT
TCAACACCATTGGGAAGGATACTTAGTAGGGTCTCGTCTGATCTAAGCAT
TATGGATCTTGACCTGCCCTTTAGCCTCAGTTATTCAATGGGAGCCACTA
TAAATTTTTATTCTAGTCTTACAGTTTTAGCAGTTGTCACATGGCAAGTC
TTAATTGTCGCTATACCAATGGTTTATGTAGTTATTCGCATGCAGAGATA
CTACATTGCCTCTGAAAAAGAAGTAATGAGGATGAATGGCACCACAAAGT
CGTCATTAGCTAATCATGTAAATGAAACTGTTGCTGGAGCTGCAACTATA
AGGGCTTTTGAGGAGGAAGATTGTTTTTTTGAGAAAAACCTTGACCTAAT
TGATATAAATGCTAGTGCTTTTTTCCATAGTTTTTCCTCAAAAGAGTGGT
TGATCCAACGGTTAGAAATAATCAGTGCAGTTGTTCTTACCACTGGAGCA
CTTTGCATGGTTATGCTCCCTCCTGGAACATTCACCTCAGGAATTATTGG
CATGGCTTTATCCTACGGCCTTTCACTAAACAATTCCTTAGTATTTTCAA
TTCAAAATCAATGCACTCTTGCGAATCACATAATATCAGTAGAGAGATTA
AATCAATATATGCATATACAAAGCGAGGCCAAGGAAACTGTAGAAGGTAA
TCGTCCTCCTCTGAATTGGCCAGTTGCAGGCAAAGTAAAAATAAACGACT
TAAAGATACGATACAGGCCTGACGGACCACTTGTACTTGACGGGATCACA
TGCACGTTTACAGCAGGGCACAAGATTGGTATTGTTGGAAGAACAGGAAG
TGGGAAATCCACTCTTATTAGTGCTTTATTTCGTCTAGTGGAACCAGCAG
GAGGGAAAATTATAGTTGATGGACTAGACATATCATCTATTGGCCTTCAA
GATTTGAGGTCGCGTTTTGCGATTATACCTCAGGATCCTACCCTATTCAA
TGGGACTGTAAAATATAACTTGGATCCTTTATCTCAACACACTGATCAAG
AGATATGGGAGGTTCTTGGGAAGTGTCAGTTGCGAGAAGTTGTCCAAGGG
AAAGAAGAGGGTTTAAACTCCTCAGTTGTTGAAGGTGGATCAAATTGGAG
CATGGGACAAAGACAGTTATTTTGTTTAGCGCGCGCTCTTTTGAGGAGAA
GTAGGATATTGGTGTTGGATGAAGCAACTGCATCAGTTGATAATTCTACA
GATCTGATTCTGCAAAAAATCATTAGGGCTGAGTTTGCAGATTGTACAGT
GATCACAGTAGCACACAGGATACCAACTGTGATGGATTGCAATATGGTTC
TTTCTATAAGTGATGGAAAATTGGCTGAGTATGATGAGCCCACAAACTTG
ATGAAGAGAGAAGAATCGTTGTTCAGGAAACTTGTCAAGGAATATCGCTC
TTACGTTCAGTCTACCAAATCGGATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR003439ABC transporter-like
IPR003593ATPase, AAA+ type, core
IPR011527ABC transporter, transmembrane domain, type 1
IPR017871ABC transporter, conserved site
IPR017940ABC transporter, integral membrane type 1
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005524ATP binding
GO:0016887ATPase activity
GO:0000166nucleotide binding
GO:0017111nucleoside-triphosphatase activity
GO:0003674molecular_function
GO:0005215transporter activity
Vocabulary: Biological Process
TermDefinition
GO:0006810transport
GO:0055085transmembrane transport
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0016021integral component of membrane
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part