Overview
NameMedtr0019s0010.1
Unique NameMedtr0019s0010.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length399
Homology
BLAST of Medtr0019s0010.1 vs. NCBI nr
Match: gi|502127764|ref|XP_004499825.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0019s0010.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|502127764|ref|XP_004499825.1|5.779710e-548.44PREDICTED: G-type lectin S-receptor-like serine/th... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 25..37
score: NAcoord: 46..57
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0019s0010.1 ID=Medtr0019s0010.1|Name=Medtr0019s0010.1|organism=Medicago truncatula|type=mRNA|length=399bp
ATGGCATTGACTTGGATTGACGCTCTTCTTCAACTCAATGTTGATGAGAT
GCACATGGAAGTCGATAGTCATACACAACAAACCATCATCATAAACACAA
TGCAGACGAACAAGATGCTCATGCTAATACTGCACACTTTCTTCTTCTGC
TTCATTATCACTTCATCTATACAATCTAATGAGACTTTGGTGTCTTCGTC
TGGAGCTTTTGAAACTGAATTCTTCAACTTCGTAATTTCACAACTTCAAT
ACTTTAGCATGAGCAATGTTAGCTGTCATTTTGTGCACGCATCACACCTG
TTGAAAGTATTTTCAAGTGCCGATGACCTATACAAAGCAAGTGACAATAA
GCATAGGTTATGGTGTCGGCCTACAAAGTACATAGGGCTTTTCAAGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated