Overview
NameMedtr0018s0320.1
Unique NameMedtr0018s0320.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length834
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006897 endocytosis
biological_process GO:0051234 establishment of localization
biological_process GO:0051179 localization
biological_process GO:0006909 phagocytosis
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0006810 transport
biological_process GO:0016192 vesicle-mediated transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0012505 endomembrane system
cellular_component GO:0005768 endosome
cellular_component GO:0000324 fungal-type vacuole
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0000323 lytic vacuole
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0000322 storage vacuole
cellular_component GO:0005773 vacuole
molecular_function GO:0015171 amino acid transmembrane transporter activity
molecular_function GO:0008509 anion transmembrane transporter activity
molecular_function GO:0046943 carboxylic acid transmembrane transporter activity
molecular_function GO:0008324 cation transmembrane transporter activity
molecular_function GO:0015326 cationic amino acid transmembrane transporter activity
molecular_function GO:0015075 ion transmembrane transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0005342 organic acid transmembrane transporter activity
molecular_function GO:0008514 organic anion transmembrane transporter activity
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF04193.9192739-19257214-693-5864.72.5e-22106.04.6e-31

Homology
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|502089540|ref|XP_004488941.1| (PREDICTED: cystinosin homolog [Cicer arietinum])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|388506624|gb|AFK41378.1| (unknown [Lotus japonicus])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|356558785|ref|XP_003547683.1| (PREDICTED: cystinosin homolog [Glycine max])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|356571457|ref|XP_003553893.1| (PREDICTED: cystinosin homolog isoform 2 [Glycine max])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|449450036|ref|XP_004142770.1| (PREDICTED: cystinosin homolog [Cucumis sativus] >gi|449483821|ref|XP_004156702.1| PREDICTED: cystinosin homolog [Cucumis sativus])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|470137891|ref|XP_004304693.1| (PREDICTED: cystinosin homolog [Fragaria vesca subsp. vesca])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|470137895|ref|XP_004304695.1| (PREDICTED: cystinosin homolog [Fragaria vesca subsp. vesca])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|590646795|ref|XP_007031721.1| (PQ-loop repeat family protein / transmembrane family protein [Theobroma cacao] >gi|508710750|gb|EOY02647.1| PQ-loop repeat family protein / transmembrane family protein [Theobroma cacao])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|224141271|ref|XP_002323998.1| (hypothetical protein POPTR_0017s10650g [Populus trichocarpa] >gi|118485298|gb|ABK94508.1| unknown [Populus trichocarpa] >gi|222867000|gb|EEF04131.1| hypothetical protein POPTR_0017s10650g [Populus trichocarpa])
BLAST of Medtr0018s0320.1 vs. NCBI nr
Match: gi|502089534|ref|XP_004488939.1| (PREDICTED: cystinosin homolog [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0018s0320.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502089540|ref|XP_004488941.1|0.000000e+091.34PREDICTED: cystinosin homolog [Cicer arietinum][more]
gi|388506624|gb|AFK41378.1|9.429200e-17687.73unknown [Lotus japonicus][more]
gi|356558785|ref|XP_003547683.1|1.622150e-17185.92PREDICTED: cystinosin homolog [Glycine max][more]
gi|356571457|ref|XP_003553893.1|8.003290e-16281.23PREDICTED: cystinosin homolog isoform 2 [Glycine m... [more]
gi|449450036|ref|XP_004142770.1|1.770740e-15073.29PREDICTED: cystinosin homolog [Cucumis sativus] >g... [more]
gi|470137891|ref|XP_004304693.1|1.864840e-14673.29PREDICTED: cystinosin homolog [Fragaria vesca subs... [more]
gi|470137895|ref|XP_004304695.1|1.060040e-14472.32PREDICTED: cystinosin homolog [Fragaria vesca subs... [more]
gi|590646795|ref|XP_007031721.1|1.372950e-14472.92PQ-loop repeat family protein / transmembrane fami... [more]
gi|224141271|ref|XP_002323998.1|5.806760e-14271.94hypothetical protein POPTR_0017s10650g [Populus tr... [more]
gi|502089534|ref|XP_004488939.1|9.646820e-14272.20PREDICTED: cystinosin homolog [Cicer arietinum][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005282Lysosomal cystine transporterTIGRFAMsTIGR009512A43: Lysosomal Cystine Transportercoord: 11..243
score: 8.1
IPR006603Cystinosin/ERS1p repeatSMARTSM00679no descriptioncoord: 26..57
score: 2.5e-07coord: 165..196
score: 2.5

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0018s0320.1 ID=Medtr0018s0320.1|Name=Medtr0018s0320.1|organism=Medicago truncatula|type=mRNA|length=834bp
ATGGCTTCATGGAATTCAGTTTCATTAGAAGTAACCTACGAAGTTCTTGG
TTGGTTCGCTTTTATTGTTTGGTCCATCAGTTTCTACCCTCAAGTCATCT
TAAATTTCCGCAGGAAAAGCGTTGTTGGACTCAACTTTGATTTCGTGCTG
TTAAATTTAACCAAGCACAGTTCATATCTTATATACAATTCTTCTCTTTA
CTTTAGCTCTGCTATTCAGAAACAATATTTTCAGAAATACGGTTATGATC
AGATGATACCTGTGGCAAAAAATGATGTTGCTTTCTCAATCCATGCTGTT
CTGCTGACAGCCATTGCATTGTTCCAGATTGCAATCTATGAACGTGGAAG
TCAGAAACTGTCCAAAATTTGTATTGGAATCGTCTCCATTGTTTGGCTTA
CTGCTGCAGTTTGTTTCTTTGTTGCTTTGTCAAATCATTCATGGCTTTGG
CTTCTCAACGTCTTCAACTCAATTCAAGTGCTTATGACTACGATAAAGTA
CATTCCCCAGGTAAGCATGAACTTCCTAAGGAAAAGTACTGATGGATGGA
GCATTGGGAACATTCTACTAGACTTTTCTGGAGGAATAGCAAACTATGGA
CAGATGGTTGTGCAATCAGTAGATCAAGATTCATGGGTCAACTTTTATGG
GAATATAGGAAAAGTGTTGCTCTCTCTGGTATCTGTATTCTTTGACATAA
TTTTCATTATTCAACATTATGTCCTGTATCCTGATAAAAAATCCTCCAAA
TTGGTGACCACCACCGAGGATGAAGATCAAATCAGAGAGCACCTCAACAG
GCCTTCTGATGAATCTCCATCAGAGAATGTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005282Lysosomal cystine transporter
IPR006603Cystinosin/ERS1p repeat
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0000322storage vacuole
GO:0000323lytic vacuole
GO:0000324fungal-type vacuole
GO:0005773vacuole
GO:0005623cell
GO:0005737cytoplasm
GO:0005768endosome
GO:0043231intracellular membrane-bounded organelle
GO:0012505endomembrane system
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0005215transporter activity
GO:0015171amino acid transmembrane transporter activity
GO:0022857transmembrane transporter activity
GO:0005342organic acid transmembrane transporter activity
GO:0008324cation transmembrane transporter activity
GO:0008509anion transmembrane transporter activity
GO:0008514organic anion transmembrane transporter activity
GO:0015075ion transmembrane transporter activity
GO:0015326cationic amino acid transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022892substrate-specific transporter activity
GO:0046943carboxylic acid transmembrane transporter activity
Vocabulary: Biological Process
TermDefinition
GO:0016192vesicle-mediated transport
GO:0006810transport
GO:0006897endocytosis
GO:0006909phagocytosis
GO:0008150biological_process
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0051179localization
GO:0051234establishment of localization